RLG00000010743

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
Physical Location & Seq
Forward (+)
4058625 .. 4059206
582 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000010743

Sequence Viewer

Length: 582 bp
ATGGATGATGAGGATCTGCTTGCTCTAATCGTCAATAAGATTAGCAACCCAGATGATAGAAGATCGTTTTTGGAGGTCTGCAAGCAATGGCTGAGAGTGGAAGGTCTAAACCGATCATCCCTTCGTCTTCTCCGATCCGAATATCTCCATCAGGTACTCCCTAGATTCCCAAATTTACTCACATTTGAAACTTCCGAGCCTATCACTCAAACCAACCTCAAGTTCATAGCTGAAACTTGTCGCGATCTCGAAGCCATCAACCTCAGTACCAAATATCACCCTCCATTTAAGAAAAGTCCTGACTATTGTGTCGATGGTATGAGCGTTTTGGCAAAGGGGTGTCCCAAACTATCCCGGGTTATGCTTAGACGGAGATTGGTGAATGTTCATCTTAAGTTTTTAAACTCAGCACACAATTTGACACATTTGGATTTGGGACATTGCTTGGTCTCGGACGAGGACCTCGAAGCAATTGGGTCTTGTAGTTCGATTAGCTACTTGAATTTGAAATGGGGTCTAATGACGGATGAAGGATTGGGTTTTCTGGCAAATGGTTCTTGCTCGAAAACCTCAAGACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

194

Amino Acids

21.92

Weight (kDa)

7.63

Isoelectric Point (pI)

48.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 308
AccII CGCG 1 cut(s) 243
AclWI GGATC 2 cut(s) 21, 129
AcsI RAATTY 2 cut(s) 172, 502
AfaI GTAC 2 cut(s) 156, 268
AflII CTTAAG 1 cut(s) 392
AgsI TTSAA 3 cut(s) 188, 502, 508
AjuI GAANNNNNNNTTGG 2 cut(s) 206, 238
AluBI AGCT 2 cut(s) 230, 495
AluI AGCT 2 cut(s) 230, 495
Alw26I GTCTC 1 cut(s) 454
AlwI GGATC 2 cut(s) 21, 129
Ama87I CYCGRG 1 cut(s) 354
ApoI RAATTY 2 cut(s) 172, 502
AspS9I GGNCC 1 cut(s) 460
AsuC2I CCSGG 2 cut(s) 355, 356
AsuHPI GGTGA 2 cut(s) 269, 391
AvaI CYCGRG 1 cut(s) 354
AvaII GGWCC 1 cut(s) 460
BaeI ACNNNNGTAYC 2 cut(s) 250, 283
BbsI GAAGAC 1 cut(s) 119
BccI CCATC 3 cut(s) 156, 263, 308
BcnI CCSGG 2 cut(s) 355, 356
BcoDI GTCTC 1 cut(s) 454
BfaI CTAG 1 cut(s) 162
BfrI CTTAAG 1 cut(s) 392
Bme1390I CCNGG 2 cut(s) 355, 356
Bme18I GGWCC 1 cut(s) 460
BmeT110I CYCGRG 1 cut(s) 354
BmgT120I GGNCC 1 cut(s) 460
BmrFI CCNGG 2 cut(s) 355, 356
BpiI GAAGAC 1 cut(s) 119
BpuEI CTTGAG 2 cut(s) 203, 556
BpuMI CCSGG 2 cut(s) 355, 356
BsaBI GATNNNNATC 1 cut(s) 12
BsaI GGTCTC 1 cut(s) 454
BsaJI CCNNGG 1 cut(s) 354
Bse3DI GCAATG 2 cut(s) 92, 439
Bse8I GATNNNNATC 1 cut(s) 12
BseDI CCNNGG 1 cut(s) 354
BseGI GGATG 3 cut(s) 10, 116, 532
BseJI GATNNNNATC 1 cut(s) 12
BseMI GCAATG 2 cut(s) 92, 439
BseMII CTCAG 3 cut(s) 83, 277, 420
Bsh1236I CGCG 1 cut(s) 243
BsiHKCI CYCGRG 1 cut(s) 354
BsiSI CCGG 1 cut(s) 355
BslFI GGGAC 2 cut(s) 327, 450
BsmAI GTCTC 1 cut(s) 454
BsmFI GGGAC 2 cut(s) 327, 450
Bso31I GGTCTC 1 cut(s) 454
BsoBI CYCGRG 1 cut(s) 354
Bsp143I GATC 5 cut(s) 13, 62, 113, 134, 244
Bsp68I TCGCGA 1 cut(s) 243
BspCNI CTCAG 3 cut(s) 84, 276, 419
BspFNI CGCG 1 cut(s) 243
BspPI GGATC 2 cut(s) 21, 129
BspTI CTTAAG 1 cut(s) 392
BspTNI GGTCTC 1 cut(s) 454
BsrDI GCAATG 2 cut(s) 92, 439
BssECI CCNNGG 1 cut(s) 354
BssMI GATC 5 cut(s) 13, 62, 113, 134, 244
BstAFI CTTAAG 1 cut(s) 392
BstC8I GCNNGC 2 cut(s) 21, 83
BstDEI CTNAG 4 cut(s) 92, 263, 365, 406
BstF5I GGATG 3 cut(s) 10, 116, 532
BstFNI CGCG 1 cut(s) 243
BstKTI GATC 5 cut(s) 16, 65, 116, 137, 247
BstMAI GTCTC 1 cut(s) 454
BstMBI GATC 5 cut(s) 13, 62, 113, 134, 244
BstSCI CCNGG 2 cut(s) 353, 354
BstUI CGCG 1 cut(s) 243
BstV2I GAAGAC 1 cut(s) 119
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BtsCI GGATG 3 cut(s) 10, 116, 532
BtuMI TCGCGA 1 cut(s) 243
Cac8I GCNNGC 2 cut(s) 21, 83
Cfr13I GGNCC 1 cut(s) 460
Cfr9I CCCGGG 1 cut(s) 354
Csp6I GTAC 2 cut(s) 155, 267
CviJI RGCY 5 cut(s) 91, 199, 230, 254, 495
CviKI_1 RGCY 5 cut(s) 91, 199, 230, 254, 495
CviQI GTAC 2 cut(s) 155, 267
DdeI CTNAG 4 cut(s) 92, 263, 365, 406
DpnI GATC 5 cut(s) 15, 64, 115, 136, 246
DpnII GATC 5 cut(s) 13, 62, 113, 134, 244
DraI TTTAAA 1 cut(s) 402
DrdI GACNNNNNNGTC 1 cut(s) 308
DseDI GACNNNNNNGTC 1 cut(s) 308
Eco31I GGTCTC 1 cut(s) 454
Eco47I GGWCC 1 cut(s) 460
Eco88I CYCGRG 1 cut(s) 354
EcoO109I RGGNCCY 1 cut(s) 460
FaiI YATR 3 cut(s) 227, 320, 362
FaqI GGGAC 2 cut(s) 327, 450
FokI GGATG 3 cut(s) 17, 103, 539
FspBI CTAG 1 cut(s) 162
HapII CCGG 1 cut(s) 355
HinfI GANTC 1 cut(s) 165
HpaII CCGG 1 cut(s) 355
HphI GGTGA 2 cut(s) 269, 391
Hpy188I TCNGA 4 cut(s) 134, 139, 196, 454
Hpy188III TCNNGA 4 cut(s) 242, 248, 299, 573
HpyAV CCTTC 3 cut(s) 95, 131, 524
HpyCH4V TGCA 1 cut(s) 81
HpyF3I CTNAG 4 cut(s) 92, 263, 365, 406
Kzo9I GATC 5 cut(s) 13, 62, 113, 134, 244
LpnPI CCDG 5 cut(s) 63, 137, 312, 368, 530
MaeI CTAG 1 cut(s) 162
MalI GATC 5 cut(s) 15, 64, 115, 136, 246
MboI GATC 5 cut(s) 13, 62, 113, 134, 244
MboII GAAGA 2 cut(s) 72, 119
MfeI CAATTG 1 cut(s) 471
MflI RGATCY 1 cut(s) 13
MluCI AATT 4 cut(s) 172, 415, 471, 502
MnlI CCTC 8 cut(s) 4, 67, 227, 272, 291, 451, 473, 580
MseI TTAA 3 cut(s) 288, 393, 401
MspCI CTTAAG 1 cut(s) 392
MspI CCGG 1 cut(s) 355
MspR9I CCNGG 2 cut(s) 355, 356
MunI CAATTG 1 cut(s) 471
MvnI CGCG 1 cut(s) 243
NciI CCSGG 2 cut(s) 355, 356
NdeII GATC 5 cut(s) 13, 62, 113, 134, 244
NruI TCGCGA 1 cut(s) 243
PcsI WCGNNNNNNNCGW 2 cut(s) 130, 462
PfeI GAWTC 1 cut(s) 165
PpuMI RGGWCCY 1 cut(s) 460
Psp5II RGGWCCY 1 cut(s) 460
PspPI GGNCC 1 cut(s) 460
PspPPI RGGWCCY 1 cut(s) 460
PsuI RGATCY 1 cut(s) 13
RruI TCGCGA 1 cut(s) 243
RsaI GTAC 2 cut(s) 156, 268
RsaNI GTAC 2 cut(s) 155, 267
SaqAI TTAA 3 cut(s) 288, 393, 401
Sau3AI GATC 5 cut(s) 13, 62, 113, 134, 244
Sau96I GGNCC 1 cut(s) 460
ScrFI CCNGG 2 cut(s) 355, 356
SetI ASST 9 cut(s) 78, 106, 156, 219, 232, 264, 465, 497, 572
SinI GGWCC 1 cut(s) 460
SmaI CCCGGG 1 cut(s) 356
SmlI CTYRAG 3 cut(s) 218, 392, 571
SmoI CTYRAG 3 cut(s) 218, 392, 571
Sse9I AATT 4 cut(s) 172, 415, 471, 502
SspMI CTAG 1 cut(s) 162
StyD4I CCNGG 2 cut(s) 353, 354
TaqI TCGA 5 cut(s) 249, 312, 465, 488, 563
TasI AATT 4 cut(s) 172, 415, 471, 502
TfiI GAWTC 1 cut(s) 165
Tru1I TTAA 3 cut(s) 288, 393, 401
Tru9I TTAA 3 cut(s) 288, 393, 401
TspDTI ATGAA 3 cut(s) 214, 377, 543
TspGWI ACGGA 2 cut(s) 385, 539
TspMI CCCGGG 1 cut(s) 354
Vha464I CTTAAG 1 cut(s) 392
VpaK11BI GGWCC 1 cut(s) 460
XapI RAATTY 2 cut(s) 172, 502
XmaI CCCGGG 1 cut(s) 354
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.