Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005634.1

Orthogroup ID

OG0008911

Physical Location & Seq

Genomic Coordinates Forward (+)

45613 .. 46563

Gene Structure 951 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005634.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 558 bp

atggaaaattgtttgctgagtgacgatgaagtaggcctaatcttcgaaaggttaagcgacccagatgatagaaaatccttctccaaagtctgcaagcaatgtctgagagtggagggtctaacccgatcatcaattcttctcctcggacctgaatttctcagtcaattccccaatttagtcacattcgaaacgtccaaggatgtcagcgaaaccgacctcaaattcatagctgaaacctgtcccaatatcgagaagatgcattgcttggaggacctgaatttggctcacttgtcatcagatgtcaccgacatcggaggtgtggcaatctcggacagcaccattgttgctcttgctgaaaattgcctcagcttggagaggcttgatttaagttggtgttcggtgactggagctggtattcgtaagttttcaagtcatatgtgcttagaatctcttgtgttgcgcttatatggtgagtatctcaatgcatgtgatgtggaacatgtgatacttggatgcccttcgctaaagtctattgtggtcgacacagtgactagttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_6

Protein Analysis

185

Amino Acids

20.35

Weight (kDa)

4.55

Isoelectric Point (pI)

39.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008911)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr6g0307011
rosa_laevigata	RLG00000010742 RLG00000010743 RLG00000027492
rosa_multiflora	Rmu_sc0000294.1_g000037 Rmu_sc0005634.1_g000009 Rmu_sc0005634.1_g000010
rosa_roxburghii	Rroxscaffold_4G00292410 Rroxscaffold_7G00161230 Rroxscaffold_7G00161240
rosa_rugosa	Rorug06G0355200
rosa_samantha	Rh1BG285900 Rh1DG317400 Rh6BG433700 Rh6BG433800 Rh6BG434100 Rh6BG501300 Rh6CG481900 Rh6CG482200 Rh6CG482300 Rh6DG468200 Rh6DG468500
rosa_wichuraiana	Rw1G028650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	540
AcsI	RAATTY	3 cut(s)	152, 221, 277
AfiI	CCNNNNNNNGG	2 cut(s)	280, 370
AflIII	ACRYGT	1 cut(s)	499
AgsI	TTSAA	1 cut(s)	429
AhlI	ACTAGT	1 cut(s)	551
AluBI	AGCT	3 cut(s)	230, 369, 410
AluI	AGCT	3 cut(s)	230, 369, 410
AoxI	GGCC	1 cut(s)	34
ApoI	RAATTY	3 cut(s)	152, 221, 277
AspLEI	GCGC	1 cut(s)	462
AspS9I	GGNCC	2 cut(s)	146, 271
AsuHPI	GGTGA	3 cut(s)	295, 412, 482
AsuII	TTCGAA	2 cut(s)	45, 186
AvaII	GGWCC	2 cut(s)	146, 271
BbvCI	CCTCAGC	1 cut(s)	365
BcuI	ACTAGT	1 cut(s)	551
BfaI	CTAG	1 cut(s)	552
Bme18I	GGWCC	2 cut(s)	146, 271
BmgT120I	GGNCC	2 cut(s)	146, 271
BmsI	GCATC	2 cut(s)	246, 503
BpmI	CTGGAG	1 cut(s)	426
Bpu10I	CCTNAGC	1 cut(s)	365
Bpu14I	TTCGAA	2 cut(s)	45, 186
BsaJI	CCNNGG	2 cut(s)	142, 195
Bsc4I	CCNNNNNNNGG	2 cut(s)	280, 370
Bse1I	ACTGG	1 cut(s)	409
Bse3DI	GCAATG	2 cut(s)	104, 259
BseDI	CCNNGG	2 cut(s)	142, 195
BseGI	GGATG	2 cut(s)	205, 518
BseLI	CCNNNNNNNGG	2 cut(s)	280, 370
BseMI	GCAATG	2 cut(s)	104, 259
BseMII	CTCAG	4 cut(s)	8, 95, 172, 379
BseNI	ACTGG	1 cut(s)	409
BseRI	GAGGAG	1 cut(s)	131
BshFI	GGCC	1 cut(s)	36
BslFI	GGGAC	1 cut(s)	225
BslI	CCNNNNNNNGG	2 cut(s)	280, 370
BsmFI	GGGAC	1 cut(s)	225
BsnI	GGCC	1 cut(s)	36
Bsp119I	TTCGAA	2 cut(s)	45, 186
Bsp143I	GATC	1 cut(s)	125
BspANI	GGCC	1 cut(s)	36
BspCNI	CTCAG	4 cut(s)	9, 96, 171, 378
BspT104I	TTCGAA	2 cut(s)	45, 186
BsrDI	GCAATG	2 cut(s)	104, 259
BsrI	ACTGG	1 cut(s)	409
BssECI	CCNNGG	2 cut(s)	142, 195
BssMI	GATC	1 cut(s)	125
BssT1I	CCWWGG	1 cut(s)	195
Bst4CI	ACNGT	1 cut(s)	547
BstBI	TTCGAA	2 cut(s)	45, 186
BstC8I	GCNNGC	1 cut(s)	95
BstDEI	CTNAG	5 cut(s)	17, 104, 158, 365, 442
BstF5I	GGATG	2 cut(s)	205, 518
BstHHI	GCGC	1 cut(s)	462
BstKTI	GATC	1 cut(s)	128
BstMBI	GATC	1 cut(s)	125
BstNSI	RCATGY	2 cut(s)	489, 503
BsuRI	GGCC	1 cut(s)	36
BtsCI	GGATG	2 cut(s)	205, 518
BtsIMutI	CAGTG	1 cut(s)	552
Cac8I	GCNNGC	1 cut(s)	95
CfoI	GCGC	1 cut(s)	462
Cfr13I	GGNCC	2 cut(s)	146, 271
CviAII	CATG	2 cut(s)	486, 500
CviJI	RGCY	6 cut(s)	36, 230, 284, 369, 379, 410
CviKI_1	RGCY	6 cut(s)	36, 230, 284, 369, 379, 410
DdeI	CTNAG	5 cut(s)	17, 104, 158, 365, 442
DpnI	GATC	1 cut(s)	127
DpnII	GATC	1 cut(s)	125
Eco130I	CCWWGG	1 cut(s)	195
Eco147I	AGGCCT	1 cut(s)	36
Eco47I	GGWCC	2 cut(s)	146, 271
EcoO109I	RGGNCCY	1 cut(s)	271
EcoT14I	CCWWGG	1 cut(s)	195
EcoT22I	ATGCAT	2 cut(s)	261, 487
ErhI	CCWWGG	1 cut(s)	195
FaeI	CATG	2 cut(s)	489, 503
FaiI	YATR	7 cut(s)	227, 435, 437, 466, 468, 487, 501
FaqI	GGGAC	1 cut(s)	225
FatI	CATG	2 cut(s)	485, 499
FauNDI	CATATG	1 cut(s)	435
FblI	GTMKAC	1 cut(s)	540
FokI	GGATG	2 cut(s)	212, 525
FspBI	CTAG	1 cut(s)	552
GlaI	GCGC	1 cut(s)	461
GsuI	CTGGAG	1 cut(s)	426
HaeIII	GGCC	1 cut(s)	36
HhaI	GCGC	1 cut(s)	462
Hin1II	CATG	2 cut(s)	489, 503
Hin6I	GCGC	1 cut(s)	460
HinP1I	GCGC	1 cut(s)	460
HincII	GTYRAC	1 cut(s)	541
HindII	GTYRAC	1 cut(s)	541
HinfI	GANTC	1 cut(s)	446
HphI	GGTGA	3 cut(s)	295, 412, 482
Hpy166II	GTNNAC	1 cut(s)	541
Hpy188I	TCNGA	5 cut(s)	105, 146, 298, 314, 331
Hpy188III	TCNNGA	1 cut(s)	250
Hpy8I	GTNNAC	1 cut(s)	541
HpyAV	CCTTC	2 cut(s)	88, 528
HpyCH4III	ACNGT	1 cut(s)	547
HpyCH4IV	ACGT	1 cut(s)	191
HpyCH4V	TGCA	3 cut(s)	93, 259, 485
HpyF3I	CTNAG	5 cut(s)	17, 104, 158, 365, 442
HpySE526I	ACGT	1 cut(s)	191
Hsp92II	CATG	2 cut(s)	489, 503
HspAI	GCGC	1 cut(s)	460
Kzo9I	GATC	1 cut(s)	125
LmnI	GCTCC	1 cut(s)	407
LpnPI	CCDG	6 cut(s)	75, 162, 250, 287, 390, 396
LweI	GCATC	2 cut(s)	246, 503
MaeI	CTAG	1 cut(s)	552
MaeII	ACGT	1 cut(s)	191
MaeIII	GTNAC	5 cut(s)	20, 178, 301, 400, 547
MalI	GATC	1 cut(s)	127
MboI	GATC	1 cut(s)	125
MboII	GAAGA	3 cut(s)	34, 128, 265
MluCI	AATT	8 cut(s)	7, 132, 152, 164, 172, 221, 277, 358
MnlI	CCTC	7 cut(s)	106, 152, 227, 262, 308, 369, 374
Mph1103I	ATGCAT	2 cut(s)	261, 487
MseI	TTAA	2 cut(s)	53, 386
NdeI	CATATG	1 cut(s)	435
NdeII	GATC	1 cut(s)	125
NlaIII	CATG	2 cut(s)	489, 503
NmuCI	GTSAC	5 cut(s)	20, 178, 301, 400, 547
NsiI	ATGCAT	2 cut(s)	261, 487
NspI	RCATGY	2 cut(s)	489, 503
NspV	TTCGAA	2 cut(s)	45, 186
PceI	AGGCCT	1 cut(s)	36
PciI	ACATGT	1 cut(s)	499
PfeI	GAWTC	1 cut(s)	446
PpuMI	RGGWCCY	1 cut(s)	271
PscI	ACATGT	1 cut(s)	499
Psp5II	RGGWCCY	1 cut(s)	271
PspPI	GGNCC	2 cut(s)	146, 271
PspPPI	RGGWCCY	1 cut(s)	271
PsrI	GAACNNNNNNTAC	2 cut(s)	489, 521
SalI	GTCGAC	1 cut(s)	539
SaqAI	TTAA	2 cut(s)	53, 386
Sau3AI	GATC	1 cut(s)	125
Sau96I	GGNCC	2 cut(s)	146, 271
SfaNI	GCATC	2 cut(s)	246, 503
SfuI	TTCGAA	2 cut(s)	45, 186
SinI	GGWCC	2 cut(s)	146, 271
SpeI	ACTAGT	1 cut(s)	551
Sse9I	AATT	8 cut(s)	7, 132, 152, 164, 172, 221, 277, 358
SseBI	AGGCCT	1 cut(s)	36
SspMI	CTAG	1 cut(s)	552
StuI	AGGCCT	1 cut(s)	36
StyI	CCWWGG	1 cut(s)	195
TaaI	ACNGT	1 cut(s)	547
TaiI	ACGT	1 cut(s)	194
TaqI	TCGA	4 cut(s)	45, 186, 249, 540
TasI	AATT	8 cut(s)	7, 132, 152, 164, 172, 221, 277, 358
TfiI	GAWTC	1 cut(s)	446
Tru1I	TTAA	2 cut(s)	53, 386
Tru9I	TTAA	2 cut(s)	53, 386
TscAI	CASTG	1 cut(s)	552
TseFI	GTSAC	5 cut(s)	20, 178, 301, 400, 547
Tsp45I	GTSAC	5 cut(s)	20, 178, 301, 400, 547
TspDTI	ATGAA	2 cut(s)	42, 214
TspRI	CASTG	1 cut(s)	552
VpaK11BI	GGWCC	2 cut(s)	146, 271
XapI	RAATTY	3 cut(s)	152, 221, 277
XceI	RCATGY	2 cut(s)	489, 503
XmiI	GTMKAC	1 cut(s)	540
XspI	CTAG	1 cut(s)	552
Zsp2I	ATGCAT	2 cut(s)	261, 487

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.