Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000294.1

Orthogroup ID

OG0008911

Physical Location & Seq

Genomic Coordinates Forward (+)

182510 .. 183115

Gene Structure 606 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000294.1_g000037.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 606 bp

atgaccaagtcagatgatagaaaatcggtgtcggaggtgtgcaagcaatggctgaaggtcaagggcctaacccgaacatcggttcgtttttccgatctcgattatctccctcggtttccaaacctagtcacgtttgagacaacatcaaagtgtatctccaagacccatatcgaattcttagcccaaacatgtcccaaaatcgaggtcatcaacttcaacagcccggtgtttctcagcatcctatttccgctcgacaatctactcgctctgtcaaagctatccaaggtttcgctcagaaggagaaggtttatagacgaagctgtttggtttaccaaggcacaaaacttgacgtatttggatttggggcattgcttccaaggtgacggcttccttaaagcatttggggcgtctcgcaacagttccgatgtggaaaactgttgggggatcacagacgacagtttagcacttttggcaaatggggcttcctcaaaaaccctcaagaaattggtgcttgcttgctgctcaccgattatggggtctctccgcctctcttttgcaggaaatgtgttgctaggaagagctgaatttggaaagctgtggggataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_6

Protein Analysis

201

Amino Acids

22.42

Weight (kDa)

9.33

Isoelectric Point (pI)

38.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008911)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr6g0307011
rosa_laevigata	RLG00000010742 RLG00000010743 RLG00000027492
rosa_multiflora	Rmu_sc0000294.1_g000037 Rmu_sc0005634.1_g000009 Rmu_sc0005634.1_g000010
rosa_roxburghii	Rroxscaffold_4G00292410 Rroxscaffold_7G00161230 Rroxscaffold_7G00161240
rosa_rugosa	Rorug06G0355200
rosa_samantha	Rh1BG285900 Rh1DG317400 Rh6BG433700 Rh6BG433800 Rh6BG434100 Rh6BG501300 Rh6CG481900 Rh6CG482200 Rh6CG482300 Rh6DG468200 Rh6DG468500
rosa_wichuraiana	Rw1G028650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	250
AciI	CCGC	2 cut(s)	248, 544
AclWI	GGATC	1 cut(s)	452
AcsI	RAATTY	2 cut(s)	173, 584
AcuI	CTGAAG	1 cut(s)	74
AcyI	GRCGYC	1 cut(s)	407
AfiI	CCNNNNNNNGG	2 cut(s)	79, 533
AflIII	ACRYGT	1 cut(s)	188
AgsI	TTSAA	1 cut(s)	217
AluBI	AGCT	4 cut(s)	277, 320, 581, 595
AluI	AGCT	4 cut(s)	277, 320, 581, 595
Alw26I	GTCTC	3 cut(s)	131, 414, 543
AlwI	GGATC	1 cut(s)	452
AoxI	GGCC	1 cut(s)	64
ApeKI	GCWGC	1 cut(s)	519
ApoI	RAATTY	2 cut(s)	173, 584
ArsI	GACNNNNNNTTYG	2 cut(s)	189, 221
AspS9I	GGNCC	1 cut(s)	64
AsuC2I	CCSGG	1 cut(s)	224
AsuHPI	GGTGA	2 cut(s)	392, 516
BbvI	GCAGC	1 cut(s)	506
BceAI	ACGGC	1 cut(s)	400
BcnI	CCSGG	1 cut(s)	224
BcoDI	GTCTC	3 cut(s)	131, 414, 543
BfaI	CTAG	2 cut(s)	125, 572
BisI	GCNGC	1 cut(s)	520
BlsI	GCNGC	1 cut(s)	521
Bme1390I	CCNGG	1 cut(s)	224
BmgT120I	GGNCC	1 cut(s)	64
BmrFI	CCNGG	1 cut(s)	224
BmsI	GCATC	1 cut(s)	246
BpuEI	CTTGAG	1 cut(s)	482
BpuMI	CCSGG	1 cut(s)	224
BsaHI	GRCGYC	1 cut(s)	407
BsaI	GGTCTC	1 cut(s)	543
BsaJI	CCNNGG	4 cut(s)	110, 282, 333, 376
Bsc4I	CCNNNNNNNGG	2 cut(s)	79, 533
Bse3DI	GCAATG	2 cut(s)	53, 367
BseDI	CCNNGG	4 cut(s)	110, 282, 333, 376
BseGI	GGATG	1 cut(s)	237
BseLI	CCNNNNNNNGG	2 cut(s)	79, 533
BseMI	GCAATG	2 cut(s)	53, 367
BseMII	CTCAG	2 cut(s)	247, 307
BseXI	GCAGC	1 cut(s)	506
BshFI	GGCC	1 cut(s)	66
BsiSI	CCGG	1 cut(s)	224
BslFI	GGGAC	1 cut(s)	177
BslI	CCNNNNNNNGG	2 cut(s)	79, 533
BsmAI	GTCTC	3 cut(s)	131, 414, 543
BsmBI	CGTCTC	1 cut(s)	414
BsmFI	GGGAC	1 cut(s)	177
BsnI	GGCC	1 cut(s)	66
Bso31I	GGTCTC	1 cut(s)	543
Bsp143I	GATC	2 cut(s)	94, 444
BspACI	CCGC	2 cut(s)	248, 544
BspANI	GGCC	1 cut(s)	66
BspCNI	CTCAG	2 cut(s)	246, 306
BspPI	GGATC	1 cut(s)	452
BspQI	GCTCTTC	1 cut(s)	571
BspTNI	GGTCTC	1 cut(s)	543
BsrBI	CCGCTC	1 cut(s)	250
BsrDI	GCAATG	2 cut(s)	53, 367
BssECI	CCNNGG	4 cut(s)	110, 282, 333, 376
BssMI	GATC	2 cut(s)	94, 444
BssNI	GRCGYC	1 cut(s)	407
BssT1I	CCWWGG	3 cut(s)	282, 333, 376
Bst4CI	ACNGT	3 cut(s)	419, 437, 458
Bst6I	CTCTTC	1 cut(s)	571
BstACI	GRCGYC	1 cut(s)	407
BstC8I	GCNNGC	3 cut(s)	44, 513, 517
BstDEI	CTNAG	3 cut(s)	178, 233, 293
BstF5I	GGATG	1 cut(s)	237
BstKTI	GATC	2 cut(s)	97, 447
BstMAI	GTCTC	3 cut(s)	131, 414, 543
BstMBI	GATC	2 cut(s)	94, 444
BstMWI	GCNNNNNNNGC	3 cut(s)	404, 470, 479
BstNSI	RCATGY	1 cut(s)	192
BstSCI	CCNGG	1 cut(s)	222
BstV1I	GCAGC	1 cut(s)	506
BsuRI	GGCC	1 cut(s)	66
BtsCI	GGATG	1 cut(s)	237
Cac8I	GCNNGC	3 cut(s)	44, 513, 517
Cfr13I	GGNCC	1 cut(s)	64
CseI	GACGC	1 cut(s)	396
CviAII	CATG	1 cut(s)	189
DdeI	CTNAG	3 cut(s)	178, 233, 293
DpnI	GATC	2 cut(s)	96, 446
DpnII	GATC	2 cut(s)	94, 444
Eam1104I	CTCTTC	1 cut(s)	571
EarI	CTCTTC	1 cut(s)	571
EciI	GGCGGA	1 cut(s)	533
Eco130I	CCWWGG	3 cut(s)	282, 333, 376
Eco31I	GGTCTC	1 cut(s)	543
Eco57I	CTGAAG	1 cut(s)	74
EcoO109I	RGGNCCY	1 cut(s)	64
EcoRI	GAATTC	1 cut(s)	173
EcoT14I	CCWWGG	3 cut(s)	282, 333, 376
ErhI	CCWWGG	3 cut(s)	282, 333, 376
Esp3I	CGTCTC	1 cut(s)	414
FaeI	CATG	1 cut(s)	192
FaiI	YATR	4 cut(s)	168, 190, 311, 533
FaqI	GGGAC	1 cut(s)	177
FatI	CATG	1 cut(s)	188
Fnu4HI	GCNGC	1 cut(s)	520
FokI	GGATG	1 cut(s)	224
Fsp4HI	GCNGC	1 cut(s)	520
FspBI	CTAG	2 cut(s)	125, 572
GluI	GCNGC	1 cut(s)	520
HaeIII	GGCC	1 cut(s)	66
HapII	CCGG	1 cut(s)	224
HgaI	GACGC	1 cut(s)	396
Hin1I	GRCGYC	1 cut(s)	407
Hin1II	CATG	1 cut(s)	192
HpaII	CCGG	1 cut(s)	224
HphI	GGTGA	2 cut(s)	392, 516
Hpy166II	GTNNAC	1 cut(s)	330
Hpy188I	TCNGA	5 cut(s)	13, 34, 94, 296, 424
Hpy188III	TCNNGA	2 cut(s)	98, 499
Hpy8I	GTNNAC	1 cut(s)	330
HpyAV	CCTTC	3 cut(s)	49, 291, 297
HpyCH4III	ACNGT	3 cut(s)	419, 437, 458
HpyCH4IV	ACGT	2 cut(s)	131, 350
HpyCH4V	TGCA	2 cut(s)	42, 557
HpyF10VI	GCNNNNNNNGC	3 cut(s)	404, 470, 479
HpyF3I	CTNAG	3 cut(s)	178, 233, 293
HpySE526I	ACGT	2 cut(s)	131, 350
Hsp92I	GRCGYC	1 cut(s)	407
Hsp92II	CATG	1 cut(s)	192
Kzo9I	GATC	2 cut(s)	94, 444
LguI	GCTCTTC	1 cut(s)	571
LpnPI	CCDG	2 cut(s)	237, 543
Lsp1109I	GCAGC	1 cut(s)	506
LweI	GCATC	1 cut(s)	246
MaeI	CTAG	2 cut(s)	125, 572
MaeII	ACGT	2 cut(s)	131, 350
MaeIII	GTNAC	2 cut(s)	127, 380
MalI	GATC	2 cut(s)	96, 446
MbiI	CCGCTC	1 cut(s)	250
MboI	GATC	2 cut(s)	94, 444
MboII	GAAGA	1 cut(s)	588
MluCI	AATT	3 cut(s)	173, 503, 584
MmeI	TCCRAC	1 cut(s)	12
MnlI	CCTC	6 cut(s)	28, 120, 196, 496, 506, 557
MseI	TTAA	1 cut(s)	393
MslI	CAYNNNNRTG	1 cut(s)	148
MspI	CCGG	1 cut(s)	224
MspR9I	CCNGG	1 cut(s)	224
MwoI	GCNNNNNNNGC	3 cut(s)	404, 470, 479
NciI	CCSGG	1 cut(s)	224
NdeII	GATC	2 cut(s)	94, 444
NlaIII	CATG	1 cut(s)	192
NmuCI	GTSAC	2 cut(s)	127, 380
NspI	RCATGY	1 cut(s)	192
PciI	ACATGT	1 cut(s)	188
PciSI	GCTCTTC	1 cut(s)	571
PflFI	GACNNNGTC	1 cut(s)	7
PkrI	GCNGC	1 cut(s)	521
PscI	ACATGT	1 cut(s)	188
PspPI	GGNCC	1 cut(s)	64
PsyI	GACNNNGTC	1 cut(s)	7
RseI	CAYNNNNRTG	1 cut(s)	148
SapI	GCTCTTC	1 cut(s)	571
SaqAI	TTAA	1 cut(s)	393
SatI	GCNGC	1 cut(s)	520
Sau3AI	GATC	2 cut(s)	94, 444
Sau96I	GGNCC	1 cut(s)	64
ScrFI	CCNGG	1 cut(s)	224
SfaNI	GCATC	1 cut(s)	246
SmiMI	CAYNNNNRTG	1 cut(s)	148
SmlI	CTYRAG	1 cut(s)	497
SmoI	CTYRAG	1 cut(s)	497
Sse9I	AATT	3 cut(s)	173, 503, 584
SsiI	CCGC	2 cut(s)	248, 544
SspMI	CTAG	2 cut(s)	125, 572
StyD4I	CCNGG	1 cut(s)	222
StyI	CCWWGG	3 cut(s)	282, 333, 376
TaaI	ACNGT	3 cut(s)	419, 437, 458
TaiI	ACGT	2 cut(s)	134, 353
TaqI	TCGA	4 cut(s)	99, 171, 201, 252
TasI	AATT	3 cut(s)	173, 503, 584
Tru1I	TTAA	1 cut(s)	393
Tru9I	TTAA	1 cut(s)	393
TseFI	GTSAC	2 cut(s)	127, 380
TseI	GCWGC	1 cut(s)	519
Tsp45I	GTSAC	2 cut(s)	127, 380
Tth111I	GACNNNGTC	1 cut(s)	7
XapI	RAATTY	2 cut(s)	173, 584
XceI	RCATGY	1 cut(s)	192
XspI	CTAG	2 cut(s)	125, 572

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.