Rh6CG482300

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Reverse (-)
64872534 .. 64873996
1463 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG482300.1

Sequence Viewer

Length: 387 bp
ATGCATGGCAAAAGAAGAACTATGGAAAATTGTTTGCCGAGTGACGATGAAGTAGGCCTAATCTTAGAAAGGTTAAGCGACCCAGATGATAGAAAATCCTTCTCCAAAGTCTGCAAGCAATGGCTGAGAGTGGAGGGTCTAACCCGACCATCAATTCTTCTCCTCGGACCTGAATTTCTCAGTCAATTCCCCAATTTAGTCACATTCGAAACGTCCAAGGATATCAGCGAAACCTGTCCCAATATCGAGGTGATCAACCTTAATTCCAAAGGCCGTCTTGACATTGCAGACAAAGGTTTATGCGCTTTGGCAAGAGGGTGTCCCAAATTGTCTCGGGTTTCGCCTAGAGGGAGAGTTTTTTTAACATGTTTCGTTTATAAACTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

128

Amino Acids

14.44

Weight (kDa)

8.82

Isoelectric Point (pI)

45.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box_5 PF18511 17 - 49 5.3e-08 F-box
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 378
AcsI RAATTY 1 cut(s) 173
AflIII ACRYGT 1 cut(s) 365
Alw26I GTCTC 1 cut(s) 336
Ama87I CYCGRG 1 cut(s) 333
AoxI GGCC 2 cut(s) 55, 271
ApoI RAATTY 1 cut(s) 173
AspLEI GCGC 1 cut(s) 305
AspS9I GGNCC 1 cut(s) 167
AsuHPI GGTGA 1 cut(s) 262
AsuII TTCGAA 1 cut(s) 207
AvaI CYCGRG 1 cut(s) 333
AvaII GGWCC 1 cut(s) 167
BccI CCATC 1 cut(s) 157
BceAI ACGGC 1 cut(s) 258
BclI TGATCA 1 cut(s) 252
BcoDI GTCTC 1 cut(s) 336
BfaI CTAG 1 cut(s) 345
Bme18I GGWCC 1 cut(s) 167
BmeT110I CYCGRG 1 cut(s) 333
BmgT120I GGNCC 1 cut(s) 167
Bpu14I TTCGAA 1 cut(s) 207
BsaJI CCNNGG 2 cut(s) 163, 216
Bse3DI GCAATG 2 cut(s) 125, 282
BseDI CCNNGG 2 cut(s) 163, 216
BseMI GCAATG 2 cut(s) 125, 282
BseMII CTCAG 2 cut(s) 116, 193
BseRI GAGGAG 1 cut(s) 152
BshFI GGCC 2 cut(s) 57, 273
BsiHKCI CYCGRG 1 cut(s) 333
BslFI GGGAC 2 cut(s) 222, 306
BsmAI GTCTC 1 cut(s) 336
BsmFI GGGAC 2 cut(s) 222, 306
BsnI GGCC 2 cut(s) 57, 273
BsoBI CYCGRG 1 cut(s) 333
Bsp119I TTCGAA 1 cut(s) 207
Bsp143I GATC 1 cut(s) 252
BspANI GGCC 2 cut(s) 57, 273
BspCNI CTCAG 2 cut(s) 117, 192
BspT104I TTCGAA 1 cut(s) 207
BsrDI GCAATG 2 cut(s) 125, 282
BssECI CCNNGG 2 cut(s) 163, 216
BssMI GATC 1 cut(s) 252
BssT1I CCWWGG 1 cut(s) 216
BstBI TTCGAA 1 cut(s) 207
BstC8I GCNNGC 1 cut(s) 116
BstDEI CTNAG 3 cut(s) 64, 125, 179
BstHHI GCGC 1 cut(s) 305
BstKTI GATC 1 cut(s) 255
BstMAI GTCTC 1 cut(s) 336
BstMBI GATC 1 cut(s) 252
BstNSI RCATGY 1 cut(s) 369
BsuRI GGCC 2 cut(s) 57, 273
Cac8I GCNNGC 1 cut(s) 116
CfoI GCGC 1 cut(s) 305
Cfr13I GGNCC 1 cut(s) 167
CviAII CATG 2 cut(s) 5, 366
CviJI RGCY 3 cut(s) 57, 124, 273
CviKI_1 RGCY 3 cut(s) 57, 124, 273
DdeI CTNAG 3 cut(s) 64, 125, 179
DpnI GATC 1 cut(s) 254
DpnII GATC 1 cut(s) 252
Eco130I CCWWGG 1 cut(s) 216
Eco147I AGGCCT 1 cut(s) 57
Eco32I GATATC 1 cut(s) 223
Eco47I GGWCC 1 cut(s) 167
Eco88I CYCGRG 1 cut(s) 333
EcoRV GATATC 1 cut(s) 223
EcoT14I CCWWGG 1 cut(s) 216
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 216
FaeI CATG 2 cut(s) 8, 369
FaiI YATR 5 cut(s) 6, 23, 301, 367, 378
FalI AAGNNNNNCTT 2 cut(s) 261, 293
FaqI GGGAC 2 cut(s) 222, 306
FatI CATG 2 cut(s) 4, 365
FbaI TGATCA 1 cut(s) 252
FspBI CTAG 1 cut(s) 345
GlaI GCGC 1 cut(s) 304
HaeIII GGCC 2 cut(s) 57, 273
HhaI GCGC 1 cut(s) 305
Hin1II CATG 2 cut(s) 8, 369
Hin6I GCGC 1 cut(s) 303
HinP1I GCGC 1 cut(s) 303
HphI GGTGA 1 cut(s) 262
Hpy188I TCNGA 1 cut(s) 167
Hpy188III TCNNGA 1 cut(s) 278
HpyAV CCTTC 1 cut(s) 109
HpyCH4IV ACGT 1 cut(s) 212
HpyCH4V TGCA 3 cut(s) 4, 114, 287
HpyF3I CTNAG 3 cut(s) 64, 125, 179
HpySE526I ACGT 1 cut(s) 212
Hsp92II CATG 2 cut(s) 8, 369
HspAI GCGC 1 cut(s) 303
Ksp22I TGATCA 1 cut(s) 252
Kzo9I GATC 1 cut(s) 252
LpnPI CCDG 3 cut(s) 96, 183, 247
MaeI CTAG 1 cut(s) 345
MaeII ACGT 1 cut(s) 212
MaeIII GTNAC 2 cut(s) 41, 199
MalI GATC 1 cut(s) 254
MboI GATC 1 cut(s) 252
MboII GAAGA 2 cut(s) 27, 149
MluCI AATT 7 cut(s) 28, 153, 173, 185, 193, 262, 326
MnlI CCTC 5 cut(s) 127, 173, 241, 308, 341
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 3 cut(s) 74, 261, 362
NdeII GATC 1 cut(s) 252
NlaIII CATG 2 cut(s) 8, 369
NmeAIII GCCGAG 1 cut(s) 63
NmuCI GTSAC 2 cut(s) 41, 199
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 369
NspV TTCGAA 1 cut(s) 207
PceI AGGCCT 1 cut(s) 57
PciI ACATGT 1 cut(s) 365
PscI ACATGT 1 cut(s) 365
PsiI TTATAA 1 cut(s) 378
PspPI GGNCC 1 cut(s) 167
SaqAI TTAA 3 cut(s) 74, 261, 362
Sau3AI GATC 1 cut(s) 252
Sau96I GGNCC 1 cut(s) 167
SetI ASST 7 cut(s) 74, 172, 215, 236, 252, 261, 298
SfuI TTCGAA 1 cut(s) 207
SinI GGWCC 1 cut(s) 167
Sse9I AATT 7 cut(s) 28, 153, 173, 185, 193, 262, 326
SseBI AGGCCT 1 cut(s) 57
SspMI CTAG 1 cut(s) 345
StuI AGGCCT 1 cut(s) 57
StyI CCWWGG 1 cut(s) 216
TaiI ACGT 1 cut(s) 215
TaqI TCGA 2 cut(s) 207, 246
TasI AATT 7 cut(s) 28, 153, 173, 185, 193, 262, 326
Tru1I TTAA 3 cut(s) 74, 261, 362
Tru9I TTAA 3 cut(s) 74, 261, 362
TseFI GTSAC 2 cut(s) 41, 199
Tsp45I GTSAC 2 cut(s) 41, 199
TspDTI ATGAA 1 cut(s) 63
VpaK11BI GGWCC 1 cut(s) 167
XapI RAATTY 1 cut(s) 173
XceI RCATGY 1 cut(s) 369
XspI CTAG 1 cut(s) 345
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.