Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005634.1

Orthogroup ID

OG0008911

Physical Location & Seq

Genomic Coordinates Forward (+)

48422 .. 49327

Gene Structure 906 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005634.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 462 bp

atggattatgaggatctgcttgctctaatcgtcaataagattagcaacccagatgatagaagatcattttcggaggtctgcaagcaatggctgagagtggaaggtctaaaccgatcatcccttaatcttctccgatccgaatatctccatcaggtactccctagattcccaaatttactcacatttgaaacttccaagcctatcactcaaaccaacctcaagttcatacctcaaacttgtcgcgatctcgaggccatcaacctcaggaccaaagatcaccctccatttaagaaaagtcctgactattgggtcgatgactgcaccattgctgctcttgctgagaactgccgcaacttggaggtgcttaatataagtcgttgttctttggtaactggagctggtattcgtgcattttcaactcatccgtacttagaatctcttgtgtatgatgggaacatgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_6

Protein Analysis

153

Amino Acids

17.6

Weight (kDa)

6.29

Isoelectric Point (pI)

40.86

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008911)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr6g0307011
rosa_laevigata	RLG00000010742 RLG00000010743 RLG00000027492
rosa_multiflora	Rmu_sc0000294.1_g000037 Rmu_sc0005634.1_g000009 Rmu_sc0005634.1_g000010
rosa_roxburghii	Rroxscaffold_4G00292410 Rroxscaffold_7G00161230 Rroxscaffold_7G00161240
rosa_rugosa	Rorug06G0355200
rosa_samantha	Rh1BG285900 Rh1DG317400 Rh6BG433700 Rh6BG433800 Rh6BG434100 Rh6BG501300 Rh6CG481900 Rh6CG482200 Rh6CG482300 Rh6DG468200 Rh6DG468500
rosa_wichuraiana	Rw1G028650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	308
AccII	CGCG	1 cut(s)	243
AciI	CCGC	1 cut(s)	349
AclWI	GGATC	2 cut(s)	21, 129
AcsI	RAATTY	1 cut(s)	172
AfaI	GTAC	2 cut(s)	156, 428
AfiI	CCNNNNNNNGG	1 cut(s)	355
AflIII	ACRYGT	1 cut(s)	456
AgsI	TTSAA	2 cut(s)	188, 417
AjuI	GAANNNNNNNTTGG	2 cut(s)	206, 238
AluBI	AGCT	1 cut(s)	398
AluI	AGCT	1 cut(s)	398
AlwI	GGATC	2 cut(s)	21, 129
Ama87I	CYCGRG	1 cut(s)	248
AoxI	GGCC	1 cut(s)	252
ApeKI	GCWGC	1 cut(s)	329
ApoI	RAATTY	1 cut(s)	172
AspS9I	GGNCC	1 cut(s)	267
AsuHPI	GGTGA	1 cut(s)	269
AvaI	CYCGRG	1 cut(s)	248
AvaII	GGWCC	1 cut(s)	267
AxyI	CCTNAGG	1 cut(s)	263
BbvI	GCAGC	1 cut(s)	316
BccI	CCATC	3 cut(s)	156, 263, 443
BfaI	CTAG	1 cut(s)	162
BisI	GCNGC	2 cut(s)	330, 349
BlsI	GCNGC	2 cut(s)	331, 350
Bme18I	GGWCC	1 cut(s)	267
BmeT110I	CYCGRG	1 cut(s)	248
BmgT120I	GGNCC	1 cut(s)	267
BpmI	CTGGAG	1 cut(s)	414
BpuEI	CTTGAG	1 cut(s)	203
Bsc4I	CCNNNNNNNGG	1 cut(s)	355
Bse1I	ACTGG	1 cut(s)	397
Bse21I	CCTNAGG	1 cut(s)	263
Bse3DI	GCAATG	2 cut(s)	92, 324
BseGI	GGATG	2 cut(s)	116, 421
BseLI	CCNNNNNNNGG	1 cut(s)	355
BseMI	GCAATG	2 cut(s)	92, 324
BseMII	CTCAG	3 cut(s)	83, 277, 330
BseNI	ACTGG	1 cut(s)	397
BseXI	GCAGC	1 cut(s)	316
BsgI	GTGCAG	1 cut(s)	304
Bsh1236I	CGCG	1 cut(s)	243
BshFI	GGCC	1 cut(s)	254
BsiHKCI	CYCGRG	1 cut(s)	248
BslI	CCNNNNNNNGG	1 cut(s)	355
BsnI	GGCC	1 cut(s)	254
BsoBI	CYCGRG	1 cut(s)	248
Bsp143I	GATC	6 cut(s)	13, 62, 113, 134, 244, 274
Bsp68I	TCGCGA	1 cut(s)	243
BspACI	CCGC	1 cut(s)	349
BspANI	GGCC	1 cut(s)	254
BspCNI	CTCAG	3 cut(s)	84, 276, 331
BspFNI	CGCG	1 cut(s)	243
BspPI	GGATC	2 cut(s)	21, 129
BsrDI	GCAATG	2 cut(s)	92, 324
BsrI	ACTGG	1 cut(s)	397
BssMI	GATC	6 cut(s)	13, 62, 113, 134, 244, 274
BstC8I	GCNNGC	2 cut(s)	21, 83
BstDEI	CTNAG	4 cut(s)	92, 263, 339, 430
BstF5I	GGATG	2 cut(s)	116, 421
BstFNI	CGCG	1 cut(s)	243
BstKTI	GATC	6 cut(s)	16, 65, 116, 137, 247, 277
BstMBI	GATC	6 cut(s)	13, 62, 113, 134, 244, 274
BstMWI	GCNNNNNNNGC	1 cut(s)	335
BstNSI	RCATGY	1 cut(s)	460
BstUI	CGCG	1 cut(s)	243
BstV1I	GCAGC	1 cut(s)	316
BstX2I	RGATCY	1 cut(s)	13
BstYI	RGATCY	1 cut(s)	13
Bsu36I	CCTNAGG	1 cut(s)	263
BsuRI	GGCC	1 cut(s)	254
BtsCI	GGATG	2 cut(s)	116, 421
BtuMI	TCGCGA	1 cut(s)	243
Cac8I	GCNNGC	2 cut(s)	21, 83
Cfr13I	GGNCC	1 cut(s)	267
Csp6I	GTAC	2 cut(s)	155, 427
CviAII	CATG	1 cut(s)	457
CviJI	RGCY	4 cut(s)	91, 199, 254, 398
CviKI_1	RGCY	4 cut(s)	91, 199, 254, 398
CviQI	GTAC	2 cut(s)	155, 427
DdeI	CTNAG	4 cut(s)	92, 263, 339, 430
DpnI	GATC	6 cut(s)	15, 64, 115, 136, 246, 276
DpnII	GATC	6 cut(s)	13, 62, 113, 134, 244, 274
DrdI	GACNNNNNNGTC	1 cut(s)	308
DseDI	GACNNNNNNGTC	1 cut(s)	308
Eco47I	GGWCC	1 cut(s)	267
Eco81I	CCTNAGG	1 cut(s)	263
Eco88I	CYCGRG	1 cut(s)	248
FaeI	CATG	1 cut(s)	460
FaiI	YATR	5 cut(s)	9, 227, 371, 447, 458
FatI	CATG	1 cut(s)	456
Fnu4HI	GCNGC	2 cut(s)	330, 349
FokI	GGATG	2 cut(s)	103, 408
Fsp4HI	GCNGC	2 cut(s)	330, 349
FspBI	CTAG	1 cut(s)	162
GluI	GCNGC	2 cut(s)	330, 349
GsuI	CTGGAG	1 cut(s)	414
HaeIII	GGCC	1 cut(s)	254
Hin1II	CATG	1 cut(s)	460
HinfI	GANTC	2 cut(s)	165, 434
HphI	GGTGA	1 cut(s)	269
Hpy188I	TCNGA	3 cut(s)	73, 134, 139
Hpy188III	TCNNGA	4 cut(s)	242, 248, 265, 299
HpyAV	CCTTC	1 cut(s)	95
HpyCH4V	TGCA	3 cut(s)	81, 321, 410
HpyF10VI	GCNNNNNNNGC	1 cut(s)	335
HpyF3I	CTNAG	4 cut(s)	92, 263, 339, 430
Hsp92II	CATG	1 cut(s)	460
Kzo9I	GATC	6 cut(s)	13, 62, 113, 134, 244, 274
LmnI	GCTCC	1 cut(s)	395
LpnPI	CCDG	6 cut(s)	63, 137, 250, 312, 378, 384
Lsp1109I	GCAGC	1 cut(s)	316
MaeI	CTAG	1 cut(s)	162
MaeIII	GTNAC	1 cut(s)	388
MalI	GATC	6 cut(s)	15, 64, 115, 136, 246, 276
MboI	GATC	6 cut(s)	13, 62, 113, 134, 244, 274
MboII	GAAGA	2 cut(s)	72, 119
MflI	RGATCY	1 cut(s)	13
MluCI	AATT	1 cut(s)	172
MnlI	CCTC	8 cut(s)	4, 67, 227, 240, 244, 272, 291, 352
MseI	TTAA	3 cut(s)	123, 288, 366
MvnI	CGCG	1 cut(s)	243
MwoI	GCNNNNNNNGC	1 cut(s)	335
NdeII	GATC	6 cut(s)	13, 62, 113, 134, 244, 274
NlaIII	CATG	1 cut(s)	460
NruI	TCGCGA	1 cut(s)	243
NspI	RCATGY	1 cut(s)	460
PaeR7I	CTCGAG	1 cut(s)	248
PciI	ACATGT	1 cut(s)	456
PfeI	GAWTC	2 cut(s)	165, 434
PkrI	GCNGC	2 cut(s)	331, 350
PscI	ACATGT	1 cut(s)	456
PspPI	GGNCC	1 cut(s)	267
PsuI	RGATCY	1 cut(s)	13
RruI	TCGCGA	1 cut(s)	243
RsaI	GTAC	2 cut(s)	156, 428
RsaNI	GTAC	2 cut(s)	155, 427
SaqAI	TTAA	3 cut(s)	123, 288, 366
SatI	GCNGC	2 cut(s)	330, 349
Sau3AI	GATC	6 cut(s)	13, 62, 113, 134, 244, 274
Sau96I	GGNCC	1 cut(s)	267
SetI	ASST	8 cut(s)	78, 106, 156, 219, 232, 264, 363, 400
Sfr274I	CTCGAG	1 cut(s)	248
SinI	GGWCC	1 cut(s)	267
SlaI	CTCGAG	1 cut(s)	248
SmlI	CTYRAG	2 cut(s)	218, 248
SmoI	CTYRAG	2 cut(s)	218, 248
Sse9I	AATT	1 cut(s)	172
SsiI	CCGC	1 cut(s)	349
SspMI	CTAG	1 cut(s)	162
TaqI	TCGA	2 cut(s)	249, 312
TasI	AATT	1 cut(s)	172
TauI	GCSGC	1 cut(s)	351
TfiI	GAWTC	2 cut(s)	165, 434
Tru1I	TTAA	3 cut(s)	123, 288, 366
Tru9I	TTAA	3 cut(s)	123, 288, 366
TseI	GCWGC	1 cut(s)	329
TspDTI	ATGAA	1 cut(s)	214
TspGWI	ACGGA	1 cut(s)	414
VpaK11BI	GGWCC	1 cut(s)	267
XapI	RAATTY	1 cut(s)	172
XceI	RCATGY	1 cut(s)	460
XhoI	CTCGAG	1 cut(s)	248
XspI	CTAG	1 cut(s)	162

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.