RLG00000036544
MYB Family

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Reverse (-)
81739030 .. 81740899
1870 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000036544

Sequence Viewer

Length: 393 bp
ATGATGGTGGTGGTGGTGGATGAAGATGAAGATTCCTCCCCAGAGATAGTCTTAAGGAATTTGGGGAAACCTGATTATGGGTATTGTAATTGCAGGAAATCGAGTTATGGGTCAAGAAAAGCTCCAAGATTGAACAATGTCAGTGATGGGTTTCAGACTCCTAGACGATCTTCAAGGTTGGGTGGTAAGCAGAATTATCAACCACAACTAATAAAGCAACTACTGGTAGATCTAAGAGCAAGTCCAAAATTTCTTTGGATAAAGAGTAAGGTCTCGGGTGTTCGGAAAGATGGAGCTTGTGTGAATTCAGATGAAATTGTTTCGGAAAAAGCAAAAGGATCCAATAATCAACTCCTTCATGGGTTGCCCTATTGCCATATGTTGATGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

131

Amino Acids

14.57

Weight (kDa)

9.39

Isoelectric Point (pI)

49.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010457)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 333, 346
AcsI RAATTY 3 cut(s) 58, 248, 304
AfiI CCNNNNNNNGG 1 cut(s) 77
AflII CTTAAG 1 cut(s) 52
AgsI TTSAA 2 cut(s) 133, 174
AluBI AGCT 2 cut(s) 122, 296
AluI AGCT 2 cut(s) 122, 296
Alw26I GTCTC 1 cut(s) 277
AlwI GGATC 2 cut(s) 333, 346
Ama87I CYCGRG 1 cut(s) 274
ApoI RAATTY 3 cut(s) 58, 248, 304
AvaI CYCGRG 1 cut(s) 274
BamHI GGATCC 1 cut(s) 338
BccI CCATC 2 cut(s) 140, 284
BcoDI GTCTC 1 cut(s) 277
BfaI CTAG 1 cut(s) 162
BfrI CTTAAG 1 cut(s) 52
BglII AGATCT 1 cut(s) 229
BmeT110I CYCGRG 1 cut(s) 274
BmiI GGNNCC 1 cut(s) 340
BsaI GGTCTC 1 cut(s) 277
BsaXI ACNNNNNCTCC 2 cut(s) 285, 315
Bsc4I CCNNNNNNNGG 1 cut(s) 77
Bse1I ACTGG 1 cut(s) 228
BseGI GGATG 1 cut(s) 25
BseLI CCNNNNNNNGG 1 cut(s) 77
BseNI ACTGG 1 cut(s) 228
BsiHKCI CYCGRG 1 cut(s) 274
BslI CCNNNNNNNGG 1 cut(s) 77
BsmAI GTCTC 1 cut(s) 277
Bso31I GGTCTC 1 cut(s) 277
BsoBI CYCGRG 1 cut(s) 274
Bsp143I GATC 3 cut(s) 167, 229, 338
BspLI GGNNCC 1 cut(s) 340
BspPI GGATC 2 cut(s) 333, 346
BspTI CTTAAG 1 cut(s) 52
BspTNI GGTCTC 1 cut(s) 277
BsrI ACTGG 1 cut(s) 228
BssMI GATC 3 cut(s) 167, 229, 338
BstAFI CTTAAG 1 cut(s) 52
BstDEI CTNAG 1 cut(s) 233
BstF5I GGATG 1 cut(s) 25
BstKTI GATC 3 cut(s) 170, 232, 341
BstMAI GTCTC 1 cut(s) 277
BstMBI GATC 3 cut(s) 167, 229, 338
BstX2I RGATCY 2 cut(s) 229, 338
BstYI RGATCY 2 cut(s) 229, 338
BtsCI GGATG 1 cut(s) 25
BtsIMutI CAGTG 1 cut(s) 148
CviAII CATG 1 cut(s) 359
CviJI RGCY 2 cut(s) 122, 296
CviKI_1 RGCY 2 cut(s) 122, 296
DdeI CTNAG 1 cut(s) 233
DpnI GATC 3 cut(s) 169, 231, 340
DpnII GATC 3 cut(s) 167, 229, 338
Eco31I GGTCTC 1 cut(s) 277
Eco88I CYCGRG 1 cut(s) 274
EcoRI GAATTC 1 cut(s) 304
FaeI CATG 1 cut(s) 362
FaiI YATR 5 cut(s) 78, 108, 360, 378, 380
FatI CATG 1 cut(s) 358
FauNDI CATATG 1 cut(s) 378
FokI GGATG 1 cut(s) 32
FspBI CTAG 1 cut(s) 162
Hin1II CATG 1 cut(s) 362
HinfI GANTC 2 cut(s) 32, 157
Hpy188I TCNGA 4 cut(s) 156, 285, 310, 325
Hpy188III TCNNGA 1 cut(s) 114
HpyAV CCTTC 1 cut(s) 365
HpyCH4V TGCA 1 cut(s) 93
HpyF3I CTNAG 1 cut(s) 233
Hsp92II CATG 1 cut(s) 362
Kzo9I GATC 3 cut(s) 167, 229, 338
LmnI GCTCC 2 cut(s) 127, 293
LpnPI CCDG 4 cut(s) 54, 79, 84, 209
MaeI CTAG 1 cut(s) 162
MalI GATC 3 cut(s) 169, 231, 340
MboI GATC 3 cut(s) 167, 229, 338
MboII GAAGA 3 cut(s) 35, 41, 162
MflI RGATCY 2 cut(s) 229, 338
MluCI AATT 6 cut(s) 58, 88, 193, 248, 304, 315
MlyI GAGTC 1 cut(s) 151
MnlI CCTC 1 cut(s) 46
MseI TTAA 1 cut(s) 53
MspCI CTTAAG 1 cut(s) 52
NdeI CATATG 1 cut(s) 378
NdeII GATC 3 cut(s) 167, 229, 338
NlaIII CATG 1 cut(s) 362
NlaIV GGNNCC 1 cut(s) 340
PfeI GAWTC 1 cut(s) 32
PleI GAGTC 1 cut(s) 151
PpsI GAGTC 1 cut(s) 151
PspN4I GGNNCC 1 cut(s) 340
PsuI RGATCY 2 cut(s) 229, 338
SaqAI TTAA 1 cut(s) 53
Sau3AI GATC 3 cut(s) 167, 229, 338
SchI GAGTC 1 cut(s) 151
SetI ASST 5 cut(s) 73, 124, 179, 273, 298
SmlI CTYRAG 1 cut(s) 52
SmoI CTYRAG 1 cut(s) 52
Sse9I AATT 6 cut(s) 58, 88, 193, 248, 304, 315
SspMI CTAG 1 cut(s) 162
TaqI TCGA 1 cut(s) 101
TasI AATT 6 cut(s) 58, 88, 193, 248, 304, 315
TfiI GAWTC 1 cut(s) 32
Tru1I TTAA 1 cut(s) 53
Tru9I TTAA 1 cut(s) 53
TscAI CASTG 1 cut(s) 148
TspDTI ATGAA 4 cut(s) 36, 42, 327, 347
TspRI CASTG 1 cut(s) 148
Vha464I CTTAAG 1 cut(s) 52
XapI RAATTY 3 cut(s) 58, 248, 304
XcmI CCANNNNNNNNNTGG 1 cut(s) 252
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.