Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8010216.1

Orthogroup ID

OG0002829

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 440

Gene Structure 439 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8010216.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 344 bp

atgtttcagcgttctgattttgatgttggcggctctttcagggcggttgtgtccaaggctcgctggaatgatgagatgggcatggctcagctcgtagttcagaagggcacattttccaagtctactggaattgttcgtagtggcaacctctattactccattgaggaagttctgtttttggttgaaataggggctttagttctattggatgagagtgatactggcctttccttggaagatgtatacgtgaagatgtcaggtgggaagtatggatgctgttgggaggaatttcgagcttataggcaactcaaatctcttggttacattgttgggcgttatggtat

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

tRNA_int_end_N2

Protein Analysis

114

Amino Acids

12.78

Weight (kDa)

5.42

Isoelectric Point (pI)

38.39

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002829)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G02370 AT3G02370 AT3G02370 AT3G02370 AT3G57360
fragaria_vesca	FvH4_6g24380 FvH4_6g24380 FvH4_6g24380 FvH4_6g24380 FvH4_6g24380 FvH4_6g24380 FvH4_6g24380 FvH4_6g24380
malus_domestica	MD12G1080400.v1.1 MD14G1076600.v1.1
prunus_persica	Prupe.5G048800_v2.0.a1 Prupe.5G048800_v2.0.a1 Prupe.5G048800_v2.0.a1 Prupe.5G048800_v2.0.a1 Prupe.5G048800_v2.0.a1 Prupe.5G048800_v2.0.a1 Prupe.7G055000_v2.0.a1
pyrus_communis	pycom12g06700 pycom14g06490
rosa_chinensis	RchiOBHm_Chr3g0483371
rosa_laevigata	RLG00000023291
rosa_multiflora	Rmu_co8010216.1_g000001 Rmu_sc0006349.1_g000013
rosa_roxburghii	Rroxscaffold_6G00398410
rosa_rugosa	Rorug03G0205200.1 Rorug03G0205300.1 Rorug03G0205400.1 Rorug03G0205500
rosa_samantha	Rh3AG253800 Rh3BG290900 Rh3CG287900 Rh3DG283700 Rh6CG217700
rosa_wichuraiana	Rw0G023700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	122, 243
AciI	CCGC	2 cut(s)	30, 44
AcsI	RAATTY	1 cut(s)	287
AfiI	CCNNNNNNNGG	1 cut(s)	232
AgsI	TTSAA	1 cut(s)	185
AluBI	AGCT	2 cut(s)	91, 296
AluI	AGCT	2 cut(s)	91, 296
AoxI	GGCC	1 cut(s)	223
ApoI	RAATTY	1 cut(s)	287
BaeGI	GKGCMC	1 cut(s)	110
BccI	CCATC	1 cut(s)	70
BisI	GCNGC	1 cut(s)	31
BlpI	GCTNAGC	1 cut(s)	87
BlsI	GCNGC	1 cut(s)	32
BmsI	GCATC	1 cut(s)	263
Bpu1102I	GCTNAGC	1 cut(s)	87
BsaAI	YACGTR	1 cut(s)	247
BsaJI	CCNNGG	2 cut(s)	54, 231
Bsc4I	CCNNNNNNNGG	1 cut(s)	232
Bse1I	ACTGG	2 cut(s)	130, 226
BseDI	CCNNGG	2 cut(s)	54, 231
BseGI	GGATG	2 cut(s)	214, 278
BseLI	CCNNNNNNNGG	1 cut(s)	232
BseMII	CTCAG	1 cut(s)	101
BseNI	ACTGG	2 cut(s)	130, 226
BseSI	GKGCMC	1 cut(s)	110
BshFI	GGCC	1 cut(s)	225
BslI	CCNNNNNNNGG	1 cut(s)	232
BsnI	GGCC	1 cut(s)	225
Bsp1286I	GDGCHC	1 cut(s)	110
Bsp1720I	GCTNAGC	1 cut(s)	87
BspACI	CCGC	2 cut(s)	30, 44
BspANI	GGCC	1 cut(s)	225
BspCNI	CTCAG	1 cut(s)	100
BsrI	ACTGG	2 cut(s)	130, 226
BssECI	CCNNGG	2 cut(s)	54, 231
BssNAI	GTATAC	1 cut(s)	244
BssT1I	CCWWGG	2 cut(s)	54, 231
Bst1107I	GTATAC	1 cut(s)	244
BstBAI	YACGTR	1 cut(s)	247
BstC8I	GCNNGC	1 cut(s)	61
BstDEI	CTNAG	1 cut(s)	87
BstF5I	GGATG	2 cut(s)	214, 278
BstSLI	GKGCMC	1 cut(s)	110
BstZ17I	GTATAC	1 cut(s)	244
BsuRI	GGCC	1 cut(s)	225
BtsCI	GGATG	2 cut(s)	214, 278
Cac8I	GCNNGC	1 cut(s)	61
CviAII	CATG	1 cut(s)	82
CviJI	RGCY	7 cut(s)	33, 59, 86, 91, 194, 225, 296
CviKI_1	RGCY	7 cut(s)	33, 59, 86, 91, 194, 225, 296
DdeI	CTNAG	1 cut(s)	87
Eco130I	CCWWGG	2 cut(s)	54, 231
EcoT14I	CCWWGG	2 cut(s)	54, 231
ErhI	CCWWGG	2 cut(s)	54, 231
FaeI	CATG	1 cut(s)	85
FaiI	YATR	5 cut(s)	83, 244, 270, 300, 339
FatI	CATG	1 cut(s)	81
FblI	GTMKAC	2 cut(s)	122, 243
Fnu4HI	GCNGC	1 cut(s)	31
FokI	GGATG	2 cut(s)	221, 285
Fsp4HI	GCNGC	1 cut(s)	31
GluI	GCNGC	1 cut(s)	31
HaeIII	GGCC	1 cut(s)	225
Hin1II	CATG	1 cut(s)	85
Hpy166II	GTNNAC	2 cut(s)	123, 244
Hpy188I	TCNGA	2 cut(s)	16, 102
Hpy8I	GTNNAC	2 cut(s)	123, 244
HpyAV	CCTTC	1 cut(s)	97
HpyCH4IV	ACGT	1 cut(s)	246
HpyF3I	CTNAG	1 cut(s)	87
HpySE526I	ACGT	1 cut(s)	246
Hsp92II	CATG	1 cut(s)	85
LpnPI	CCDG	5 cut(s)	25, 49, 111, 207, 243
LweI	GCATC	1 cut(s)	263
MaeII	ACGT	1 cut(s)	246
MaeIII	GTNAC	1 cut(s)	320
MboII	GAAGA	2 cut(s)	248, 262
MhlI	GDGCHC	1 cut(s)	110
MluCI	AATT	2 cut(s)	129, 287
MnlI	CCTC	3 cut(s)	157, 158, 277
NlaIII	CATG	1 cut(s)	85
PkrI	GCNGC	1 cut(s)	32
Ppu21I	YACGTR	1 cut(s)	247
SatI	GCNGC	1 cut(s)	31
SduI	GDGCHC	1 cut(s)	110
SetI	ASST	5 cut(s)	93, 150, 249, 262, 298
SfaNI	GCATC	1 cut(s)	263
Sse9I	AATT	2 cut(s)	129, 287
SsiI	CCGC	2 cut(s)	30, 44
StyI	CCWWGG	2 cut(s)	54, 231
TaiI	ACGT	1 cut(s)	249
TaqI	TCGA	1 cut(s)	292
TasI	AATT	2 cut(s)	129, 287
TauI	GCSGC	1 cut(s)	33
XapI	RAATTY	1 cut(s)	287
XmiI	GTMKAC	2 cut(s)	122, 243

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.