Rmu_co8069900.1_g000001
MYB Family

Myb-like protein X

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8069900.1
OG0003553
Physical Location & Seq
Reverse (-)
2 .. 458
457 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8069900.1_g000001.1.cds

Sequence Viewer

Length: 457 bp
atggtcagattggtggccaagggaactggcatgttggctgaagttaaggaaactagcaaggacaagagagctgatatccgaaagcctgatgtgcaagaagtcagagttgcaacacgggttagtggaagtgcaatggtgcagaaccctggcggaatggttcaacccaaagttaaaggatttccgaaaccactggagagcaatgttgaaagaaagactgatggaaaagaaaagaccaaagagaaggaaggtgatgataaacgaggggaaaagcgcaaggataaagatagagagaagaaaacccaggggagagataaggatagagataaagagaagaagaaggaggagaaagcaaagaagaagaatgcgtcaaagactgcagagccagataaagagaagaaaaaggaagacaaagcaaatgagaaaaatggttctaagcatgcagaaccagacaaatcta
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

152

Amino Acids

17.18

Weight (kDa)

9.83

Isoelectric Point (pI)

13.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 150
AcoI YGGCCR 1 cut(s) 15
AcuI CTGAAG 1 cut(s) 60
AgsI TTSAA 2 cut(s) 161, 206
AjnI CCWGG 2 cut(s) 145, 300
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
AoxI GGCC 1 cut(s) 15
AspLEI GCGC 1 cut(s) 273
AsuHPI GGTGA 1 cut(s) 260
BalI TGGCCA 1 cut(s) 17
BbsI GAAGAC 1 cut(s) 411
BccI CCATC 1 cut(s) 212
BciT130I CCWGG 2 cut(s) 147, 302
BfaI CTAG 1 cut(s) 54
BfmI CTRYAG 1 cut(s) 375
Bme1390I CCNGG 2 cut(s) 147, 302
BmrFI CCNGG 2 cut(s) 147, 302
BpiI GAAGAC 1 cut(s) 411
BpmI CTGGAG 1 cut(s) 212
BsaJI CCNNGG 4 cut(s) 18, 145, 300, 301
Bse1I ACTGG 2 cut(s) 31, 195
Bse3DI GCAATG 2 cut(s) 138, 205
BseBI CCWGG 2 cut(s) 147, 302
BseDI CCNNGG 4 cut(s) 18, 145, 300, 301
BseMI GCAATG 2 cut(s) 138, 205
BseNI ACTGG 2 cut(s) 31, 195
BseRI GAGGAG 1 cut(s) 356
BsgI GTGCAG 1 cut(s) 158
BshFI GGCC 1 cut(s) 17
BsmI GAATGC 1 cut(s) 367
BsnI GGCC 1 cut(s) 17
BspACI CCGC 1 cut(s) 150
BspANI GGCC 1 cut(s) 17
BspMAI CTGCAG 1 cut(s) 379
BsrDI GCAATG 2 cut(s) 138, 205
BsrI ACTGG 2 cut(s) 31, 195
BssECI CCNNGG 4 cut(s) 18, 145, 300, 301
BssT1I CCWWGG 1 cut(s) 18
Bst2UI CCWGG 2 cut(s) 147, 302
BstC8I GCNNGC 1 cut(s) 438
BstDEI CTNAG 1 cut(s) 432
BstHHI GCGC 1 cut(s) 273
BstMWI GCNNNNNNNGC 1 cut(s) 91
BstNI CCWGG 2 cut(s) 147, 302
BstNSI RCATGY 2 cut(s) 34, 440
BstSCI CCNGG 2 cut(s) 145, 300
BstSFI CTRYAG 1 cut(s) 375
BstV2I GAAGAC 1 cut(s) 411
BsuRI GGCC 1 cut(s) 17
BtsIMutI CAGTG 1 cut(s) 188
Cac8I GCNNGC 1 cut(s) 438
CfoI GCGC 1 cut(s) 273
CseI GACGC 1 cut(s) 354
CviAII CATG 2 cut(s) 31, 437
CviJI RGCY 5 cut(s) 17, 38, 71, 85, 382
CviKI_1 RGCY 5 cut(s) 17, 38, 71, 85, 382
DdeI CTNAG 1 cut(s) 432
EaeI YGGCCR 1 cut(s) 15
EciI GGCGGA 1 cut(s) 165
Eco130I CCWWGG 1 cut(s) 18
Eco32I GATATC 1 cut(s) 76
Eco57I CTGAAG 1 cut(s) 60
EcoRII CCWGG 2 cut(s) 145, 300
EcoRV GATATC 1 cut(s) 76
EcoT14I CCWWGG 1 cut(s) 18
ErhI CCWWGG 1 cut(s) 18
FaeI CATG 2 cut(s) 34, 440
FaiI YATR 2 cut(s) 32, 438
FatI CATG 2 cut(s) 30, 436
FspBI CTAG 1 cut(s) 54
GlaI GCGC 1 cut(s) 272
GsuI CTGGAG 1 cut(s) 212
HaeIII GGCC 1 cut(s) 17
HgaI GACGC 1 cut(s) 354
HhaI GCGC 1 cut(s) 273
Hin1II CATG 2 cut(s) 34, 440
Hin6I GCGC 1 cut(s) 271
HinP1I GCGC 1 cut(s) 271
HphI GGTGA 1 cut(s) 260
Hpy188I TCNGA 4 cut(s) 8, 80, 104, 183
HpyAV CCTTC 3 cut(s) 235, 239, 331
HpyCH4V TGCA 6 cut(s) 94, 110, 131, 139, 377, 440
HpyF10VI GCNNNNNNNGC 1 cut(s) 91
HpyF3I CTNAG 1 cut(s) 432
Hsp92II CATG 2 cut(s) 34, 440
HspAI GCGC 1 cut(s) 271
LpnPI CCDG 8 cut(s) 12, 99, 132, 159, 176, 287, 314, 396
MaeI CTAG 1 cut(s) 54
MboII GAAGA 7 cut(s) 304, 343, 346, 367, 370, 406, 416
MlsI TGGCCA 1 cut(s) 17
MluNI TGGCCA 1 cut(s) 17
MnlI CCTC 2 cut(s) 254, 334
Mox20I TGGCCA 1 cut(s) 17
MscI TGGCCA 1 cut(s) 17
MseI TTAA 2 cut(s) 45, 171
Msp20I TGGCCA 1 cut(s) 17
MspR9I CCNGG 2 cut(s) 147, 302
Mva1269I GAATGC 1 cut(s) 367
MvaI CCWGG 2 cut(s) 147, 302
MwoI GCNNNNNNNGC 1 cut(s) 91
NlaIII CATG 2 cut(s) 34, 440
NspI RCATGY 2 cut(s) 34, 440
PaeI GCATGC 1 cut(s) 440
PasI CCCWGGG 1 cut(s) 301
PctI GAATGC 1 cut(s) 367
Psp6I CCWGG 2 cut(s) 145, 300
PspGI CCWGG 2 cut(s) 145, 300
PstI CTGCAG 1 cut(s) 379
SaqAI TTAA 2 cut(s) 45, 171
ScrFI CCNGG 2 cut(s) 147, 302
SetI ASST 2 cut(s) 73, 250
SfcI CTRYAG 1 cut(s) 375
SphI GCATGC 1 cut(s) 440
SsiI CCGC 1 cut(s) 150
SspMI CTAG 1 cut(s) 54
StyD4I CCNGG 2 cut(s) 145, 300
StyI CCWWGG 1 cut(s) 18
Tru1I TTAA 2 cut(s) 45, 171
Tru9I TTAA 2 cut(s) 45, 171
TscAI CASTG 1 cut(s) 195
TspRI CASTG 1 cut(s) 195
XceI RCATGY 2 cut(s) 34, 440
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.