Rmu_co8085934.1_g000001

Phd finger protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8085934.1
Physical Location & Seq
Reverse (-)
1 .. 553
553 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8085934.1_g000001.1.cds

Sequence Viewer

Length: 296 bp
atgtggctatggcattgtctattttgttttttattctgtgtaattaacaccagtgttgtgcttatagagaaggagaacttgtgtctatatggactgccaaatgaggcatgggaagttaaccttcctgttgaggaggtgcctcctgagcttcctgaaccagcattaggtataaactttgctagagatgggatggcggagaaggactggttgtcgctggttgcagttcacagtgattcgtggttgcttgctgttgcattctattttggtgcacgctttgggtttggcaaaaatgaaag

Protein Analysis

98

Amino Acids

11.18

Weight (kDa)

4.51

Isoelectric Point (pI)

49.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 136
AciI CCGC 1 cut(s) 194
AfiI CCNNNNNNNGG 1 cut(s) 164
AhdI GACNNNNNGTC 1 cut(s) 208
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
Alw21I GWGCWC 1 cut(s) 271
Alw44I GTGCAC 1 cut(s) 267
ApaLI GTGCAC 1 cut(s) 267
BaeGI GKGCMC 1 cut(s) 271
BanI GGYRCC 1 cut(s) 136
Bbv12I GWGCWC 1 cut(s) 271
BccI CCATC 2 cut(s) 179, 184
BfaI CTAG 1 cut(s) 180
BmeRI GACNNNNNGTC 1 cut(s) 208
BmiI GGNNCC 1 cut(s) 138
Bpu10I CCTNAGC 1 cut(s) 144
BsaXI ACNNNNNCTCC 2 cut(s) 65, 95
Bsc4I CCNNNNNNNGG 1 cut(s) 164
Bse1I ACTGG 2 cut(s) 51, 209
BseGI GGATG 1 cut(s) 195
BseLI CCNNNNNNNGG 1 cut(s) 164
BseMII CTCAG 1 cut(s) 135
BseNI ACTGG 2 cut(s) 51, 209
BseRI GAGGAG 1 cut(s) 146
BseSI GKGCMC 1 cut(s) 271
BshNI GGYRCC 1 cut(s) 136
BsiHKAI GWGCWC 1 cut(s) 271
BslI CCNNNNNNNGG 1 cut(s) 164
BsmI GAATGC 1 cut(s) 254
Bsp1286I GDGCHC 1 cut(s) 271
BspACI CCGC 1 cut(s) 194
BspCNI CTCAG 1 cut(s) 136
BspLI GGNNCC 1 cut(s) 138
BspT107I GGYRCC 1 cut(s) 136
BsrI ACTGG 2 cut(s) 51, 209
Bst4CI ACNGT 1 cut(s) 230
BstC8I GCNNGC 2 cut(s) 246, 271
BstDEI CTNAG 1 cut(s) 144
BstF5I GGATG 1 cut(s) 195
BstMWI GCNNNNNNNGC 1 cut(s) 145
BstSLI GKGCMC 1 cut(s) 271
BtsCI GGATG 1 cut(s) 195
BtsIMutI CAGTG 2 cut(s) 58, 235
Cac8I GCNNGC 2 cut(s) 246, 271
CviAII CATG 1 cut(s) 108
CviJI RGCY 2 cut(s) 7, 148
CviKI_1 RGCY 2 cut(s) 7, 148
DdeI CTNAG 1 cut(s) 144
DriI GACNNNNNGTC 1 cut(s) 208
Eam1105I GACNNNNNGTC 1 cut(s) 208
EciI GGCGGA 1 cut(s) 209
FaeI CATG 1 cut(s) 111
FaiI YATR 6 cut(s) 10, 65, 88, 90, 109, 170
FalI AAGNNNNNCTT 4 cut(s) 62, 94, 105, 137
FatI CATG 1 cut(s) 107
FokI GGATG 1 cut(s) 202
FspBI CTAG 1 cut(s) 180
Hin1II CATG 1 cut(s) 111
HincII GTYRAC 1 cut(s) 118
HindII GTYRAC 1 cut(s) 118
HinfI GANTC 1 cut(s) 233
HpaI GTTAAC 1 cut(s) 118
Hpy166II GTNNAC 3 cut(s) 118, 226, 269
Hpy188III TCNNGA 2 cut(s) 143, 152
Hpy8I GTNNAC 3 cut(s) 118, 226, 269
HpyAV CCTTC 3 cut(s) 64, 131, 193
HpyCH4III ACNGT 1 cut(s) 230
HpyCH4V TGCA 3 cut(s) 221, 254, 269
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
HpyF3I CTNAG 1 cut(s) 144
Hsp92II CATG 1 cut(s) 111
KspAI GTTAAC 1 cut(s) 118
LpnPI CCDG 7 cut(s) 64, 138, 156, 165, 171, 190, 200
MaeI CTAG 1 cut(s) 180
MhlI GDGCHC 1 cut(s) 271
MluCI AATT 1 cut(s) 42
MnlI CCTC 4 cut(s) 97, 124, 127, 150
MseI TTAA 2 cut(s) 45, 117
Mva1269I GAATGC 1 cut(s) 254
MwoI GCNNNNNNNGC 1 cut(s) 145
NlaIII CATG 1 cut(s) 111
NlaIV GGNNCC 1 cut(s) 138
PctI GAATGC 1 cut(s) 254
PfeI GAWTC 1 cut(s) 233
PspN4I GGNNCC 1 cut(s) 138
SaqAI TTAA 2 cut(s) 45, 117
SduI GDGCHC 1 cut(s) 271
SetI ASST 4 cut(s) 123, 138, 150, 169
Sse9I AATT 1 cut(s) 42
SsiI CCGC 1 cut(s) 194
SspMI CTAG 1 cut(s) 180
TaaI ACNGT 1 cut(s) 230
TasI AATT 1 cut(s) 42
TfiI GAWTC 1 cut(s) 233
Tru1I TTAA 2 cut(s) 45, 117
Tru9I TTAA 2 cut(s) 45, 117
TscAI CASTG 2 cut(s) 58, 235
TspRI CASTG 2 cut(s) 58, 235
VneI GTGCAC 1 cut(s) 267
XcmI CCANNNNNNNNNTGG 1 cut(s) 105
XspI CTAG 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.