Rmu_co8172902.1_g000001

Belongs to the small heat shock protein (HSP20) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8172902.1
Physical Location & Seq
Reverse (-)
2 .. 653
652 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8172902.1_g000001.1.cds

Sequence Viewer

Length: 265 bp
atgatttttcttccttctcctccaactgaaaaagagtggtcaaatattgtagctgcaaccaaaaatggatttgcattgactgggagtgcggcaacaggacagataggaccaactataggactcattgacattggagagtctgaggactcctacctgtttcgtgtatctcttcccggagtgagaagagatgaaagggaattcagctgtgaagttgaaaatgaaggacaagtattgataagaggggtgacaataacaggtgaaaaga

Protein Analysis

88

Amino Acids

9.5

Weight (kDa)

4.58

Isoelectric Point (pI)

38.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 89
AcsI RAATTY 1 cut(s) 197
AfiI CCNNNNNNNGG 1 cut(s) 116
AgsI TTSAA 1 cut(s) 215
AluBI AGCT 2 cut(s) 53, 204
AluI AGCT 2 cut(s) 53, 204
ApeKI GCWGC 1 cut(s) 53
ApoI RAATTY 1 cut(s) 197
AspS9I GGNCC 1 cut(s) 107
AsuC2I CCSGG 1 cut(s) 174
AsuHPI GGTGA 1 cut(s) 256
AvaII GGWCC 1 cut(s) 107
BbvI GCAGC 1 cut(s) 40
BcnI CCSGG 1 cut(s) 174
BfmI CTRYAG 1 cut(s) 114
BisI GCNGC 2 cut(s) 54, 90
BlsI GCNGC 2 cut(s) 55, 91
Bme1390I CCNGG 1 cut(s) 174
Bme18I GGWCC 1 cut(s) 107
BmgT120I GGNCC 1 cut(s) 107
BmrFI CCNGG 1 cut(s) 174
BmrI ACTGGG 1 cut(s) 90
BmuI ACTGGG 1 cut(s) 90
BpuMI CCSGG 1 cut(s) 174
Bsc4I CCNNNNNNNGG 1 cut(s) 116
Bse1I ACTGG 1 cut(s) 85
BseLI CCNNNNNNNGG 1 cut(s) 116
BseMII CTCAG 1 cut(s) 132
BseNI ACTGG 1 cut(s) 85
BseRI GAGGAG 1 cut(s) 9
BseXI GCAGC 1 cut(s) 40
BsiSI CCGG 1 cut(s) 174
BslI CCNNNNNNNGG 1 cut(s) 116
BspACI CCGC 1 cut(s) 89
BspCNI CTCAG 1 cut(s) 133
BsrI ACTGG 1 cut(s) 85
Bst6I CTCTTC 2 cut(s) 174, 178
BstDEI CTNAG 1 cut(s) 141
BstSCI CCNGG 1 cut(s) 172
BstSFI CTRYAG 1 cut(s) 114
BstV1I GCAGC 1 cut(s) 40
Cfr13I GGNCC 1 cut(s) 107
CviJI RGCY 2 cut(s) 53, 204
CviKI_1 RGCY 2 cut(s) 53, 204
DdeI CTNAG 1 cut(s) 141
Eam1104I CTCTTC 2 cut(s) 174, 178
EarI CTCTTC 2 cut(s) 174, 178
Eco47I GGWCC 1 cut(s) 107
EcoRI GAATTC 1 cut(s) 197
FaiI YATR 1 cut(s) 116
Fnu4HI GCNGC 2 cut(s) 54, 90
Fsp4HI GCNGC 2 cut(s) 54, 90
GluI GCNGC 2 cut(s) 54, 90
HapII CCGG 1 cut(s) 174
HinfI GANTC 3 cut(s) 120, 137, 146
HpaII CCGG 1 cut(s) 174
HphI GGTGA 1 cut(s) 256
Hpy188I TCNGA 1 cut(s) 142
HpyAV CCTTC 2 cut(s) 24, 215
HpyCH4V TGCA 2 cut(s) 56, 74
HpyF3I CTNAG 1 cut(s) 141
LpnPI CCDG 5 cut(s) 66, 81, 167, 187, 240
Lsp1109I GCAGC 1 cut(s) 40
MaeIII GTNAC 1 cut(s) 244
MboII GAAGA 2 cut(s) 161, 195
MluCI AATT 1 cut(s) 197
MlyI GAGTC 3 cut(s) 114, 140, 146
MmeI TCCRAC 1 cut(s) 47
MnlI CCTC 3 cut(s) 30, 136, 233
MspA1I CMGCKG 1 cut(s) 204
MspI CCGG 1 cut(s) 174
MspR9I CCNGG 1 cut(s) 174
NciI CCSGG 1 cut(s) 174
NmuCI GTSAC 1 cut(s) 244
PfoI TCCNGGA 1 cut(s) 172
PkrI GCNGC 2 cut(s) 55, 91
PleI GAGTC 3 cut(s) 114, 140, 145
PpsI GAGTC 3 cut(s) 114, 140, 145
PspPI GGNCC 1 cut(s) 107
PvuII CAGCTG 1 cut(s) 204
SatI GCNGC 2 cut(s) 54, 90
Sau96I GGNCC 1 cut(s) 107
SchI GAGTC 3 cut(s) 114, 140, 146
ScrFI CCNGG 1 cut(s) 174
SetI ASST 4 cut(s) 55, 156, 206, 259
SfcI CTRYAG 1 cut(s) 114
SgeI CNNG 7 cut(s) 93, 108, 166, 173, 185, 186, 239
SinI GGWCC 1 cut(s) 107
Sse9I AATT 1 cut(s) 197
SsiI CCGC 1 cut(s) 89
SspI AATATT 1 cut(s) 46
StyD4I CCNGG 1 cut(s) 172
TasI AATT 1 cut(s) 197
TauI GCSGC 1 cut(s) 92
TseFI GTSAC 1 cut(s) 244
TseI GCWGC 1 cut(s) 53
Tsp45I GTSAC 1 cut(s) 244
TspDTI ATGAA 2 cut(s) 204, 234
VpaK11BI GGWCC 1 cut(s) 107
XapI RAATTY 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.