Rmu_co8222306.1_g000001
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8222306.1
Physical Location & Seq
Forward (+)
1 .. 742
742 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8222306.1_g000001.1.cds

Sequence Viewer

Length: 688 bp
gtacaatatcctctaacttttccttgcttacatcgttgacagatttgagactcaatgataatttcttgactgggactatacctgtggagcttacgaaacttccaaaccttaagaatgtagatttctcaaacaataggctctatggtaaagtacctgtgtttcgagatggtgtggttgtgaaattagagggaaaccctgatataggtaaggaccagcctagcacgcctagcacacctccgggtccggttccggctcctaatggtggaggtgacaagaaatcccagactggtgtgattattggggttgttgtcggatgtattgttggattggttctagttggggttctcgtcttttgtatgctgaagaaaaaacagaggcgttctggtaaagtgcaaagtccaaattcgttggttatacaccctcgtcattctggtgatcaaaatgctgtcaaaatttcagttgctaataggttaaatagcactggaaatgagtcttacaatagtcccccaaataatggacctaatgacatccaggttgaggctggaaatatgatcatttctatccaagttttgaggagtgtgaccaataacttcaatgaagataagatattgggaaaaggtgggtttggaactgtgtatggaggagaattgcatgatggaacaaaaattgcagtgaagagaatggaatc

Protein Analysis

229

Amino Acids

24.37

Weight (kDa)

9.49

Isoelectric Point (pI)

27.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 514
AcsI RAATTY 2 cut(s) 402, 452
AcuI CTGAAG 1 cut(s) 382
AfaI GTAC 2 cut(s) 3, 152
AfiI CCNNNNNNNGG 4 cut(s) 202, 262, 514, 537
AflII CTTAAG 1 cut(s) 109
AgsI TTSAA 1 cut(s) 594
AjnI CCWGG 1 cut(s) 530
AluBI AGCT 1 cut(s) 90
AluI AGCT 1 cut(s) 90
Alw26I GTCTC 1 cut(s) 42
ApoI RAATTY 2 cut(s) 402, 452
AspS9I GGNCC 3 cut(s) 210, 241, 517
AsuC2I CCSGG 1 cut(s) 239
AsuHPI GGTGA 2 cut(s) 280, 445
AvaII GGWCC 3 cut(s) 210, 241, 517
BccI CCATC 2 cut(s) 160, 649
BciT130I CCWGG 1 cut(s) 532
BclI TGATCA 2 cut(s) 435, 551
BcnI CCSGG 1 cut(s) 239
BcoDI GTCTC 1 cut(s) 42
BfaI CTAG 3 cut(s) 218, 227, 334
BfrI CTTAAG 1 cut(s) 109
Bme1390I CCNGG 2 cut(s) 239, 532
Bme18I GGWCC 3 cut(s) 210, 241, 517
BmgT120I GGNCC 3 cut(s) 210, 241, 517
BmiI GGNNCC 3 cut(s) 242, 248, 254
BmrFI CCNGG 2 cut(s) 239, 532
BmrI ACTGGG 1 cut(s) 80
BmuI ACTGGG 1 cut(s) 80
BpuMI CCSGG 1 cut(s) 239
BsaWI WCCGGW 1 cut(s) 243
Bsc4I CCNNNNNNNGG 4 cut(s) 202, 262, 514, 537
Bse1I ACTGG 3 cut(s) 75, 291, 486
BseBI CCWGG 1 cut(s) 532
BseGI GGATG 2 cut(s) 319, 527
BseLI CCNNNNNNNGG 4 cut(s) 202, 262, 514, 537
BseNI ACTGG 3 cut(s) 75, 291, 486
BseRI GAGGAG 2 cut(s) 588, 656
BsiSI CCGG 3 cut(s) 238, 244, 250
BslFI GGGAC 2 cut(s) 87, 488
BslI CCNNNNNNNGG 4 cut(s) 202, 262, 514, 537
BsmAI GTCTC 1 cut(s) 42
BsmFI GGGAC 2 cut(s) 87, 488
Bsp143I GATC 2 cut(s) 435, 551
BspLI GGNNCC 3 cut(s) 242, 248, 254
BspTI CTTAAG 1 cut(s) 109
BsrI ACTGG 3 cut(s) 75, 291, 486
BssMI GATC 2 cut(s) 435, 551
Bst2UI CCWGG 1 cut(s) 532
Bst4CI ACNGT 1 cut(s) 633
Bst6I CTCTTC 1 cut(s) 670
BstAFI CTTAAG 1 cut(s) 109
BstC8I GCNNGC 1 cut(s) 223
BstENI CCTNNNNNAGG 1 cut(s) 200
BstF5I GGATG 2 cut(s) 319, 527
BstKTI GATC 2 cut(s) 438, 554
BstMAI GTCTC 1 cut(s) 42
BstMBI GATC 2 cut(s) 435, 551
BstMWI GCNNNNNNNGC 2 cut(s) 222, 227
BstNI CCWGG 1 cut(s) 532
BstSCI CCNGG 2 cut(s) 237, 530
BtsCI GGATG 2 cut(s) 319, 527
BtsI GCAGTG 1 cut(s) 677
BtsIMutI CAGTG 2 cut(s) 479, 677
Cac8I GCNNGC 1 cut(s) 223
Cfr13I GGNCC 3 cut(s) 210, 241, 517
Csp6I GTAC 2 cut(s) 2, 151
CviAII CATG 1 cut(s) 652
CviJI RGCY 5 cut(s) 90, 138, 216, 253, 541
CviKI_1 RGCY 5 cut(s) 90, 138, 216, 253, 541
CviQI GTAC 2 cut(s) 2, 151
DpnI GATC 2 cut(s) 437, 553
DpnII GATC 2 cut(s) 435, 551
Eam1104I CTCTTC 1 cut(s) 670
EarI CTCTTC 1 cut(s) 670
Eco47I GGWCC 3 cut(s) 210, 241, 517
Eco57I CTGAAG 1 cut(s) 382
EcoNI CCTNNNNNAGG 1 cut(s) 200
EcoRII CCWGG 1 cut(s) 530
FaeI CATG 1 cut(s) 655
FaiI YATR 8 cut(s) 79, 143, 202, 358, 415, 550, 638, 653
FaqI GGGAC 2 cut(s) 87, 488
FatI CATG 1 cut(s) 651
FbaI TGATCA 2 cut(s) 435, 551
FokI GGATG 2 cut(s) 326, 514
FspBI CTAG 3 cut(s) 218, 227, 334
HapII CCGG 3 cut(s) 238, 244, 250
Hin1II CATG 1 cut(s) 655
HincII GTYRAC 1 cut(s) 38
HindII GTYRAC 1 cut(s) 38
HinfI GANTC 3 cut(s) 50, 490, 685
HpaII CCGG 3 cut(s) 238, 244, 250
HphI GGTGA 2 cut(s) 280, 445
Hpy166II GTNNAC 1 cut(s) 38
Hpy188I TCNGA 1 cut(s) 313
Hpy188III TCNNGA 2 cut(s) 66, 163
Hpy8I GTNNAC 1 cut(s) 38
HpyCH4III ACNGT 1 cut(s) 633
HpyCH4V TGCA 3 cut(s) 393, 651, 670
HpyF10VI GCNNNNNNNGC 2 cut(s) 222, 227
Hsp92II CATG 1 cut(s) 655
Ksp22I TGATCA 2 cut(s) 435, 551
Kzo9I GATC 2 cut(s) 435, 551
LmnI GCTCC 2 cut(s) 87, 258
MaeI CTAG 3 cut(s) 218, 227, 334
MaeIII GTNAC 2 cut(s) 268, 579
MalI GATC 2 cut(s) 437, 553
MboI GATC 2 cut(s) 435, 551
MboII GAAGA 3 cut(s) 375, 610, 687
MluCI AATT 6 cut(s) 60, 181, 402, 452, 646, 665
MlyI GAGTC 2 cut(s) 44, 499
MmeI TCCRAC 2 cut(s) 291, 303
MnlI CCTC 9 cut(s) 21, 180, 245, 259, 368, 431, 531, 566, 634
MseI TTAA 2 cut(s) 110, 472
MslI CAYNNNNRTG 1 cut(s) 431
MspCI CTTAAG 1 cut(s) 109
MspI CCGG 3 cut(s) 238, 244, 250
MspR9I CCNGG 2 cut(s) 239, 532
MvaI CCWGG 1 cut(s) 532
MwoI GCNNNNNNNGC 2 cut(s) 222, 227
NciI CCSGG 1 cut(s) 239
NdeII GATC 2 cut(s) 435, 551
NlaIII CATG 1 cut(s) 655
NlaIV GGNNCC 3 cut(s) 242, 248, 254
NmuCI GTSAC 2 cut(s) 268, 579
PfeI GAWTC 1 cut(s) 685
PflMI CCANNNNNTGG 1 cut(s) 514
PleI GAGTC 2 cut(s) 44, 498
PpsI GAGTC 2 cut(s) 44, 498
Psp6I CCWGG 1 cut(s) 530
PspGI CCWGG 1 cut(s) 530
PspN4I GGNNCC 3 cut(s) 242, 248, 254
PspPI GGNCC 3 cut(s) 210, 241, 517
RsaI GTAC 2 cut(s) 3, 152
RsaNI GTAC 2 cut(s) 2, 151
RseI CAYNNNNRTG 1 cut(s) 431
SaqAI TTAA 2 cut(s) 110, 472
Sau3AI GATC 2 cut(s) 435, 551
Sau96I GGNCC 3 cut(s) 210, 241, 517
SchI GAGTC 2 cut(s) 44, 499
ScrFI CCNGG 2 cut(s) 239, 532
SinI GGWCC 3 cut(s) 210, 241, 517
SmiMI CAYNNNNRTG 1 cut(s) 431
SmlI CTYRAG 1 cut(s) 109
SmoI CTYRAG 1 cut(s) 109
Sse9I AATT 6 cut(s) 60, 181, 402, 452, 646, 665
SspMI CTAG 3 cut(s) 218, 227, 334
StyD4I CCNGG 2 cut(s) 237, 530
TaaI ACNGT 1 cut(s) 633
TaqI TCGA 1 cut(s) 162
TasI AATT 6 cut(s) 60, 181, 402, 452, 646, 665
TfiI GAWTC 1 cut(s) 685
Tru1I TTAA 2 cut(s) 110, 472
Tru9I TTAA 2 cut(s) 110, 472
TscAI CASTG 2 cut(s) 486, 677
TseFI GTSAC 2 cut(s) 268, 579
Tsp45I GTSAC 2 cut(s) 268, 579
TspDTI ATGAA 1 cut(s) 611
TspRI CASTG 2 cut(s) 486, 677
Van91I CCANNNNNTGG 1 cut(s) 514
Vha464I CTTAAG 1 cut(s) 109
VpaK11BI GGWCC 3 cut(s) 210, 241, 517
XagI CCTNNNNNAGG 1 cut(s) 200
XapI RAATTY 2 cut(s) 402, 452
XcmI CCANNNNNNNNNTGG 1 cut(s) 538
XspI CTAG 3 cut(s) 218, 227, 334
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.