Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8259875.1

Orthogroup ID

OG0005042

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 806

Gene Structure 806 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8259875.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 240 bp

gataccttgatggtcttggagatgctgttgagcaaggccttgtgaaggcagttggtgtctcaaactatagagaaaagagattgcgtgatgcatacgagaaactcaaaaagagaggtatcccactagcatcaaaccaagtgaattacagcctcatatacagggcaccagaggagaacggagttaaggctacctgtgacgaacttgggatcactttgattgcctattcacctattgctcaag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009526 GO:0009532 GO:0009534 GO:0009535 GO:0009536 GO:0009570 GO:0009579 GO:0009941 GO:0010287 GO:0016020 GO:0031967 GO:0031975 GO:0031976 GO:0031984 GO:0034357 GO:0042651 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044436 GO:0044444 GO:0044446 GO:0044464 GO:0055035

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Aldo_ket_red

Protein Analysis

79

Amino Acids

8.71

Weight (kDa)

8.04

Isoelectric Point (pI)

23.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005042)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G06690
fragaria_vesca	FvH4_6g38930 FvH4_6g38930 FvH4_6g38930 FvH4_6g38930 FvH4_6g38930 FvH4_6g38930
malus_domestica	MD01G1007000.v1.1 MD09G1146100.v1.1 MD11G1199500.v1.1 MD17G1132700.v1.1
prunus_persica	Prupe.3G179600_v2.0.a1 Prupe.3G179600_v2.0.a1 Prupe.3G179600_v2.0.a1 Prupe.3G179600_v2.0.a1
pyrus_communis	pycom09g06640 pycom10g09970 pycom11g17240
rosa_chinensis	RchiOBHm_Chr2g0152501
rosa_laevigata	RLG00000020641
rosa_multiflora	Rmu_co8259875.1_g000001 Rmu_co8302601.1_g000001 Rmu_sc0014904.1_g000007
rosa_roxburghii	Rroxscaffold_5G00362420
rosa_rugosa	Rorug02G0433900
rosa_samantha	Rh1CG062100 Rh2AG495300 Rh2CG481400 Rh2DG518500
rosa_wichuraiana	Rw2G040750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	162
AclWI	GGATC	1 cut(s)	214
AfiI	CCNNNNNNNGG	1 cut(s)	45
Alw26I	GTCTC	1 cut(s)	63
AlwI	GGATC	1 cut(s)	214
AoxI	GGCC	1 cut(s)	36
AsuHPI	GGTGA	1 cut(s)	218
BaeGI	GKGCMC	1 cut(s)	165
BanI	GGYRCC	1 cut(s)	162
BccI	CCATC	1 cut(s)	4
BciVI	GTATCC	1 cut(s)	127
BcoDI	GTCTC	1 cut(s)	63
BfaI	CTAG	1 cut(s)	124
BfmI	CTRYAG	1 cut(s)	66
BfuI	GTATCC	1 cut(s)	127
BmiI	GGNNCC	1 cut(s)	164
BmsI	GCATC	3 cut(s)	12, 78, 136
BpuEI	CTTGAG	1 cut(s)	221
BsaXI	ACNNNNNCTCC	2 cut(s)	11, 41
Bsc4I	CCNNNNNNNGG	1 cut(s)	45
BseLI	CCNNNNNNNGG	1 cut(s)	45
BseRI	GAGGAG	1 cut(s)	184
BseSI	GKGCMC	1 cut(s)	165
BshFI	GGCC	1 cut(s)	38
BshNI	GGYRCC	1 cut(s)	162
BslI	CCNNNNNNNGG	1 cut(s)	45
BsmAI	GTCTC	1 cut(s)	63
BsnI	GGCC	1 cut(s)	38
Bsp1286I	GDGCHC	1 cut(s)	165
Bsp143I	GATC	1 cut(s)	206
BspANI	GGCC	1 cut(s)	38
BspLI	GGNNCC	1 cut(s)	164
BspPI	GGATC	1 cut(s)	214
BspT107I	GGYRCC	1 cut(s)	162
BssMI	GATC	1 cut(s)	206
BstENI	CCTNNNNNAGG	1 cut(s)	43
BstKTI	GATC	1 cut(s)	209
BstMAI	GTCTC	1 cut(s)	63
BstMBI	GATC	1 cut(s)	206
BstSFI	CTRYAG	1 cut(s)	66
BstSLI	GKGCMC	1 cut(s)	165
BsuI	GTATCC	1 cut(s)	127
BsuRI	GGCC	1 cut(s)	38
CviJI	RGCY	3 cut(s)	38, 149, 187
CviKI_1	RGCY	3 cut(s)	38, 149, 187
DpnI	GATC	1 cut(s)	208
DpnII	GATC	1 cut(s)	206
Eco147I	AGGCCT	1 cut(s)	38
EcoNI	CCTNNNNNAGG	1 cut(s)	43
EcoT22I	ATGCAT	1 cut(s)	93
FaiI	YATR	4 cut(s)	68, 93, 154, 156
FspBI	CTAG	1 cut(s)	124
HaeIII	GGCC	1 cut(s)	38
HphI	GGTGA	1 cut(s)	218
HpyAV	CCTTC	1 cut(s)	39
HpyCH4V	TGCA	1 cut(s)	91
Kzo9I	GATC	1 cut(s)	206
LpnPI	CCDG	3 cut(s)	144, 179, 204
LweI	GCATC	3 cut(s)	12, 78, 136
MaeI	CTAG	1 cut(s)	124
MaeIII	GTNAC	1 cut(s)	193
MalI	GATC	1 cut(s)	208
MboI	GATC	1 cut(s)	206
MhlI	GDGCHC	1 cut(s)	165
MluCI	AATT	1 cut(s)	141
MnlI	CCTC	3 cut(s)	106, 160, 162
Mph1103I	ATGCAT	1 cut(s)	93
MseI	TTAA	1 cut(s)	182
NdeII	GATC	1 cut(s)	206
NlaIV	GGNNCC	1 cut(s)	164
NmuCI	GTSAC	1 cut(s)	193
NsiI	ATGCAT	1 cut(s)	93
PceI	AGGCCT	1 cut(s)	38
PspN4I	GGNNCC	1 cut(s)	164
SaqAI	TTAA	1 cut(s)	182
Sau3AI	GATC	1 cut(s)	206
SduI	GDGCHC	1 cut(s)	165
SetI	ASST	4 cut(s)	8, 117, 193, 231
SfaNI	GCATC	3 cut(s)	12, 78, 136
SfcI	CTRYAG	1 cut(s)	66
SmlI	CTYRAG	1 cut(s)	236
SmoI	CTYRAG	1 cut(s)	236
Sse9I	AATT	1 cut(s)	141
SseBI	AGGCCT	1 cut(s)	38
SspMI	CTAG	1 cut(s)	124
StuI	AGGCCT	1 cut(s)	38
TasI	AATT	1 cut(s)	141
Tru1I	TTAA	1 cut(s)	182
Tru9I	TTAA	1 cut(s)	182
TseFI	GTSAC	1 cut(s)	193
Tsp45I	GTSAC	1 cut(s)	193
TspGWI	ACGGA	1 cut(s)	191
XagI	CCTNNNNNAGG	1 cut(s)	43
XspI	CTAG	1 cut(s)	124
Zsp2I	ATGCAT	1 cut(s)	93

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.