Rmu_co8279775.1_g000001

RNA binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8279775.1
OG0010172
Physical Location & Seq
Forward (+)
213 .. 846
634 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8279775.1_g000001.1.cds

Sequence Viewer

Length: 485 bp
atggacgttttggtgggatccacctcggcggcgacggcttcctgtctgtttctcaaccaaaacggcgtcgtaggagggggaaaatcggggatcggagcttgcggcggagggaaggctcgatcggagcaggcggactcgttttcgagcagttcttcgtcctccatcggggctccggatgacagtgacgaagaaaatgcatccaaggaaggatccggtgacgtcactgacagcgaggaggttcagagcaagtttaacggccgaggaggattgacttctctgggatcaatgggctctctagaagattctcttcccatcaagaggggattatcgaactacttctcaggaaaatcgaaatcgtttgcgagtttatcagatgttgtgaccaccgccacgacggtgaaggaggtggagaagagggagaacccattcaacaagaggagaagggttttaatcgcctcaaagtggtccagaaagtcgtcgtcgtc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

162

Amino Acids

16.68

Weight (kDa)

7.72

Isoelectric Point (pI)

58.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 222
AccIII TCCGGA 1 cut(s) 172
AciI CCGC 5 cut(s) 29, 102, 105, 131, 387
AclWI GGATC 6 cut(s) 12, 25, 98, 204, 217, 289
AcoI YGGCCR 1 cut(s) 256
AcyI GRCGYC 2 cut(s) 66, 219
AfiI CCNNNNNNNGG 3 cut(s) 165, 318, 462
AgsI TTSAA 1 cut(s) 430
AleI CACNNNNGTG 1 cut(s) 395
AluBI AGCT 1 cut(s) 98
AluI AGCT 1 cut(s) 98
AlwI GGATC 6 cut(s) 12, 25, 98, 204, 217, 289
Aor13HI TCCGGA 1 cut(s) 172
AoxI GGCC 1 cut(s) 256
Asp700I GAANNNNTTC 2 cut(s) 335, 425
AspS9I GGNCC 1 cut(s) 465
AsuHPI GGTGA 2 cut(s) 227, 409
AvaII GGWCC 1 cut(s) 465
BamHI GGATCC 2 cut(s) 17, 209
BanII GRGCYC 2 cut(s) 172, 293
BccI CCATC 2 cut(s) 170, 320
BceAI ACGGC 3 cut(s) 51, 79, 271
BcgI CGANNNNNNTGC 2 cut(s) 176, 210
BfaI CTAG 1 cut(s) 296
BisI GCNGC 2 cut(s) 30, 103
BlsI GCNGC 2 cut(s) 31, 104
Bme18I GGWCC 1 cut(s) 465
BmgT120I GGNCC 1 cut(s) 465
BmiI GGNNCC 3 cut(s) 19, 171, 211
BmsI GCATC 1 cut(s) 206
BsaHI GRCGYC 2 cut(s) 66, 219
BsaJI CCNNGG 3 cut(s) 24, 201, 259
BsaWI WCCGGW 2 cut(s) 172, 212
Bsc4I CCNNNNNNNGG 3 cut(s) 165, 318, 462
BseAI TCCGGA 1 cut(s) 172
BseDI CCNNGG 3 cut(s) 24, 201, 259
BseGI GGATG 2 cut(s) 181, 197
BseLI CCNNNNNNNGG 3 cut(s) 165, 318, 462
BseMII CTCAG 1 cut(s) 354
BseRI GAGGAG 3 cut(s) 248, 276, 451
BseX3I CGGCCG 1 cut(s) 256
Bsh1285I CGRYCG 2 cut(s) 122, 259
BshFI GGCC 1 cut(s) 258
BsiEI CGRYCG 2 cut(s) 122, 259
BsiSI CCGG 2 cut(s) 173, 213
BslI CCNNNNNNNGG 3 cut(s) 165, 318, 462
BsnI GGCC 1 cut(s) 258
Bsp1286I GDGCHC 2 cut(s) 172, 293
Bsp13I TCCGGA 1 cut(s) 172
Bsp143I GATC 5 cut(s) 17, 90, 119, 209, 281
BspACI CCGC 5 cut(s) 29, 102, 105, 131, 387
BspANI GGCC 1 cut(s) 258
BspCNI CTCAG 1 cut(s) 353
BspEI TCCGGA 1 cut(s) 172
BspLI GGNNCC 3 cut(s) 19, 171, 211
BspPI GGATC 6 cut(s) 12, 25, 98, 204, 217, 289
BssECI CCNNGG 3 cut(s) 24, 201, 259
BssMI GATC 5 cut(s) 17, 90, 119, 209, 281
BssNI GRCGYC 2 cut(s) 66, 219
BssT1I CCWWGG 1 cut(s) 201
Bst4CI ACNGT 2 cut(s) 182, 397
Bst6I CTCTTC 2 cut(s) 312, 407
BstACI GRCGYC 2 cut(s) 66, 219
BstC8I GCNNGC 2 cut(s) 100, 129
BstDEI CTNAG 1 cut(s) 340
BstF5I GGATG 2 cut(s) 181, 197
BstKTI GATC 5 cut(s) 20, 93, 122, 212, 284
BstMBI GATC 5 cut(s) 17, 90, 119, 209, 281
BstMCI CGRYCG 2 cut(s) 122, 259
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstX2I RGATCY 2 cut(s) 17, 209
BstYI RGATCY 2 cut(s) 17, 209
BstZI CGGCCG 1 cut(s) 256
BsuRI GGCC 1 cut(s) 258
BtsCI GGATG 2 cut(s) 181, 197
BtsIMutI CAGTG 2 cut(s) 187, 222
Cac8I GCNNGC 2 cut(s) 100, 129
Cfr13I GGNCC 1 cut(s) 465
CseI GACGC 1 cut(s) 55
CviJI RGCY 6 cut(s) 38, 98, 116, 170, 258, 291
CviKI_1 RGCY 6 cut(s) 38, 98, 116, 170, 258, 291
DdeI CTNAG 1 cut(s) 340
DpnI GATC 5 cut(s) 19, 92, 121, 211, 283
DpnII GATC 5 cut(s) 17, 90, 119, 209, 281
EaeI YGGCCR 1 cut(s) 256
EagI CGGCCG 1 cut(s) 256
Eam1104I CTCTTC 2 cut(s) 312, 407
EarI CTCTTC 2 cut(s) 312, 407
EciI GGCGGA 2 cut(s) 120, 146
EclXI CGGCCG 1 cut(s) 256
Eco130I CCWWGG 1 cut(s) 201
Eco24I GRGCYC 2 cut(s) 172, 293
Eco47I GGWCC 1 cut(s) 465
Eco52I CGGCCG 1 cut(s) 256
EcoT14I CCWWGG 1 cut(s) 201
EcoT22I ATGCAT 1 cut(s) 199
EcoT38I GRGCYC 2 cut(s) 172, 293
ErhI CCWWGG 1 cut(s) 201
FalI AAGNNNNNCTT 2 cut(s) 291, 323
Fnu4HI GCNGC 2 cut(s) 30, 103
FokI GGATG 2 cut(s) 184, 188
FriOI GRGCYC 2 cut(s) 172, 293
Fsp4HI GCNGC 2 cut(s) 30, 103
FspBI CTAG 1 cut(s) 296
GluI GCNGC 2 cut(s) 30, 103
HaeIII GGCC 1 cut(s) 258
HapII CCGG 2 cut(s) 173, 213
HgaI GACGC 1 cut(s) 55
Hin1I GRCGYC 2 cut(s) 66, 219
HinfI GANTC 2 cut(s) 134, 302
HpaII CCGG 2 cut(s) 173, 213
HphI GGTGA 2 cut(s) 227, 409
Hpy188I TCNGA 4 cut(s) 95, 124, 243, 373
Hpy188III TCNNGA 5 cut(s) 173, 296, 316, 342, 468
Hpy99I CGWCG 5 cut(s) 37, 71, 397, 481, 484
HpyAV CCTTC 4 cut(s) 106, 200, 394, 435
HpyCH4III ACNGT 2 cut(s) 182, 397
HpyCH4IV ACGT 2 cut(s) 6, 219
HpyCH4V TGCA 1 cut(s) 197
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
HpyF3I CTNAG 1 cut(s) 340
HpySE526I ACGT 2 cut(s) 6, 219
Hsp92I GRCGYC 2 cut(s) 66, 219
Kpn2I TCCGGA 1 cut(s) 172
Kzo9I GATC 5 cut(s) 17, 90, 119, 209, 281
LmnI GCTCC 3 cut(s) 95, 124, 175
LpnPI CCDG 7 cut(s) 55, 113, 186, 226, 263, 327, 481
LweI GCATC 1 cut(s) 206
MaeI CTAG 1 cut(s) 296
MaeII ACGT 2 cut(s) 6, 219
MaeIII GTNAC 4 cut(s) 182, 215, 220, 379
MalI GATC 5 cut(s) 19, 92, 121, 211, 283
MboI GATC 5 cut(s) 17, 90, 119, 209, 281
MboII GAAGA 5 cut(s) 144, 200, 299, 311, 424
MflI RGATCY 2 cut(s) 17, 209
MhlI GDGCHC 2 cut(s) 172, 293
MlyI GAGTC 1 cut(s) 128
Mph1103I ATGCAT 1 cut(s) 199
MroI TCCGGA 1 cut(s) 172
MroXI GAANNNNTTC 2 cut(s) 335, 425
MseI TTAA 2 cut(s) 252, 449
MslI CAYNNNNRTG 1 cut(s) 395
MspI CCGG 2 cut(s) 173, 213
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeII GATC 5 cut(s) 17, 90, 119, 209, 281
NlaIV GGNNCC 3 cut(s) 19, 171, 211
NmeAIII GCCGAG 2 cut(s) 5, 284
NmuCI GTSAC 4 cut(s) 182, 215, 220, 379
NsiI ATGCAT 1 cut(s) 199
OliI CACNNNNGTG 1 cut(s) 395
PdmI GAANNNNTTC 2 cut(s) 335, 425
PfeI GAWTC 1 cut(s) 302
PkrI GCNGC 2 cut(s) 31, 104
Ple19I CGATCG 1 cut(s) 122
PleI GAGTC 1 cut(s) 128
PpsI GAGTC 1 cut(s) 128
PspN4I GGNNCC 3 cut(s) 19, 171, 211
PspPI GGNCC 1 cut(s) 465
PsuI RGATCY 2 cut(s) 17, 209
PvuI CGATCG 1 cut(s) 122
RseI CAYNNNNRTG 1 cut(s) 395
SaqAI TTAA 2 cut(s) 252, 449
SatI GCNGC 2 cut(s) 30, 103
Sau3AI GATC 5 cut(s) 17, 90, 119, 209, 281
Sau96I GGNCC 1 cut(s) 465
SchI GAGTC 1 cut(s) 128
SduI GDGCHC 2 cut(s) 172, 293
SetI ASST 6 cut(s) 9, 26, 100, 222, 240, 408
SfaNI GCATC 1 cut(s) 206
SinI GGWCC 1 cut(s) 465
SmiMI CAYNNNNRTG 1 cut(s) 395
SsiI CCGC 5 cut(s) 29, 102, 105, 131, 387
SspMI CTAG 1 cut(s) 296
StyI CCWWGG 1 cut(s) 201
TaaI ACNGT 2 cut(s) 182, 397
TaiI ACGT 2 cut(s) 9, 222
TaqI TCGA 4 cut(s) 118, 143, 329, 350
TauI GCSGC 2 cut(s) 32, 105
TfiI GAWTC 1 cut(s) 302
Tru1I TTAA 2 cut(s) 252, 449
Tru9I TTAA 2 cut(s) 252, 449
TscAI CASTG 2 cut(s) 187, 229
TseFI GTSAC 4 cut(s) 182, 215, 220, 379
Tsp45I GTSAC 4 cut(s) 182, 215, 220, 379
TspRI CASTG 2 cut(s) 187, 229
VpaK11BI GGWCC 1 cut(s) 465
XbaI TCTAGA 1 cut(s) 295
XmnI GAANNNNTTC 2 cut(s) 335, 425
XspI CTAG 1 cut(s) 296
ZraI GACGTC 1 cut(s) 220
Zsp2I ATGCAT 1 cut(s) 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.