Rmu_co8298143.1_g000001

mRNA-binding protein involved in proper cytoplasmic distribution of mitochondria

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8298143.1
OG0005851
Physical Location & Seq
Forward (+)
1 .. 888
888 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8298143.1_g000001.1.cds

Sequence Viewer

Length: 396 bp
gcattatcttcttgacttgatgagagtaactcctcgtgatgcaaacttcactggatctgggtctcgattttgtatcttgagaccagaactaattacttcctattgccaggtccttgatgcagagaaatcaaaatcgaagtctaaatgtgaaggagaggctcaggtcaccgctgatgggccaaacgataaccaggacatcgcacaaaaagagaagaccgttgatgcacaagaaattgtctcaccaccagctgaaagctctgaatcacatgaggaaactcttttcaaccctaatgtcttcactgagtttaagttggctggaaatgcggaggagatagcaacagatgaagaaaatgtgaggaaagccagtttgtatcttactgaggttgttcttccgaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CLU CLU_N DUF727 TPR_10 TPR_12 eIF3_p135

Protein Analysis

131

Amino Acids

14.51

Weight (kDa)

4.55

Isoelectric Point (pI)

38.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 169, 324
AclWI GGATC 1 cut(s) 62
AfiI CCNNNNNNNGG 1 cut(s) 175
AgsI TTSAA 1 cut(s) 284
AjnI CCWGG 2 cut(s) 106, 190
AluBI AGCT 2 cut(s) 249, 256
AluI AGCT 2 cut(s) 249, 256
Alw26I GTCTC 3 cut(s) 67, 74, 242
AlwI GGATC 1 cut(s) 62
AoxI GGCC 1 cut(s) 177
ArsI GACNNNNNNTTYG 2 cut(s) 123, 155
AspS9I GGNCC 2 cut(s) 110, 177
AsuHPI GGTGA 2 cut(s) 158, 232
AvaII GGWCC 1 cut(s) 110
BauI CACGAG 1 cut(s) 34
BbsI GAAGAC 2 cut(s) 219, 287
BccI CCATC 1 cut(s) 168
BciT130I CCWGG 2 cut(s) 108, 192
BcoDI GTCTC 3 cut(s) 67, 74, 242
Bme1390I CCNGG 2 cut(s) 108, 192
Bme18I GGWCC 1 cut(s) 110
BmgT120I GGNCC 2 cut(s) 110, 177
BmrFI CCNGG 2 cut(s) 108, 192
BmsI GCATC 3 cut(s) 29, 107, 212
BpiI GAAGAC 2 cut(s) 219, 287
BplI GAGNNNNNCTC 2 cut(s) 14, 46
Bpu10I CCTNAGC 1 cut(s) 160
BpuEI CTTGAG 1 cut(s) 98
BsaI GGTCTC 2 cut(s) 67, 74
Bsc4I CCNNNNNNNGG 1 cut(s) 175
Bse1I ACTGG 2 cut(s) 56, 364
BseBI CCWGG 2 cut(s) 108, 192
BseLI CCNNNNNNNGG 1 cut(s) 175
BseMII CTCAG 3 cut(s) 174, 292, 370
BseNI ACTGG 2 cut(s) 56, 364
BseRI GAGGAG 2 cut(s) 22, 342
BshFI GGCC 1 cut(s) 179
BslI CCNNNNNNNGG 1 cut(s) 175
BsmAI GTCTC 3 cut(s) 67, 74, 242
BsnI GGCC 1 cut(s) 179
Bso31I GGTCTC 2 cut(s) 67, 74
Bsp143I GATC 1 cut(s) 54
BspACI CCGC 2 cut(s) 169, 324
BspANI GGCC 1 cut(s) 179
BspCNI CTCAG 3 cut(s) 173, 293, 371
BspPI GGATC 1 cut(s) 62
BspTNI GGTCTC 2 cut(s) 67, 74
BsrI ACTGG 2 cut(s) 56, 364
BssMI GATC 1 cut(s) 54
BssSI CACGAG 1 cut(s) 34
Bst2BI CACGAG 1 cut(s) 34
Bst2UI CCWGG 2 cut(s) 108, 192
Bst4CI ACNGT 1 cut(s) 218
BstDEI CTNAG 3 cut(s) 160, 301, 379
BstEII GGTNACC 1 cut(s) 164
BstKTI GATC 1 cut(s) 57
BstMAI GTCTC 3 cut(s) 67, 74, 242
BstMBI GATC 1 cut(s) 54
BstMWI GCNNNNNNNGC 1 cut(s) 321
BstNI CCWGG 2 cut(s) 108, 192
BstPI GGTNACC 1 cut(s) 164
BstSCI CCNGG 2 cut(s) 106, 190
BstV2I GAAGAC 2 cut(s) 219, 287
BstX2I RGATCY 1 cut(s) 54
BstYI RGATCY 1 cut(s) 54
BsuRI GGCC 1 cut(s) 179
BtgZI GCGATG 1 cut(s) 182
BtsIMutI CAGTG 2 cut(s) 49, 298
Cfr13I GGNCC 2 cut(s) 110, 177
CviAII CATG 1 cut(s) 267
CviJI RGCY 6 cut(s) 159, 179, 249, 256, 315, 363
CviKI_1 RGCY 6 cut(s) 159, 179, 249, 256, 315, 363
DdeI CTNAG 3 cut(s) 160, 301, 379
DpnI GATC 1 cut(s) 56
DpnII GATC 1 cut(s) 54
Eco31I GGTCTC 2 cut(s) 67, 74
Eco47I GGWCC 1 cut(s) 110
Eco91I GGTNACC 1 cut(s) 164
EcoO109I RGGNCCY 1 cut(s) 110
EcoO65I GGTNACC 1 cut(s) 164
EcoRII CCWGG 2 cut(s) 106, 190
FaeI CATG 1 cut(s) 270
FaiI YATR 1 cut(s) 268
FatI CATG 1 cut(s) 266
HaeIII GGCC 1 cut(s) 179
Hin1II CATG 1 cut(s) 270
HinfI GANTC 1 cut(s) 261
HphI GGTGA 2 cut(s) 158, 232
Hpy188I TCNGA 2 cut(s) 260, 394
Hpy188III TCNNGA 4 cut(s) 12, 36, 64, 77
HpyAV CCTTC 1 cut(s) 144
HpyCH4III ACNGT 1 cut(s) 218
HpyCH4V TGCA 3 cut(s) 42, 120, 225
HpyF10VI GCNNNNNNNGC 1 cut(s) 321
HpyF3I CTNAG 3 cut(s) 160, 301, 379
Hsp92II CATG 1 cut(s) 270
Kzo9I GATC 1 cut(s) 54
LweI GCATC 3 cut(s) 29, 107, 212
MaeIII GTNAC 2 cut(s) 26, 164
MalI GATC 1 cut(s) 56
MboI GATC 1 cut(s) 54
MboII GAAGA 4 cut(s) 224, 287, 357, 381
MflI RGATCY 1 cut(s) 54
MluCI AATT 2 cut(s) 91, 232
MnlI CCTC 6 cut(s) 43, 149, 263, 320, 349, 374
MseI TTAA 1 cut(s) 307
MspA1I CMGCKG 2 cut(s) 171, 249
MspR9I CCNGG 2 cut(s) 108, 192
MvaI CCWGG 2 cut(s) 108, 192
MwoI GCNNNNNNNGC 1 cut(s) 321
NdeII GATC 1 cut(s) 54
NlaIII CATG 1 cut(s) 270
NmuCI GTSAC 1 cut(s) 164
PfeI GAWTC 1 cut(s) 261
PpuMI RGGWCCY 1 cut(s) 110
Psp5II RGGWCCY 1 cut(s) 110
Psp6I CCWGG 2 cut(s) 106, 190
PspEI GGTNACC 1 cut(s) 164
PspGI CCWGG 2 cut(s) 106, 190
PspPI GGNCC 2 cut(s) 110, 177
PspPPI RGGWCCY 1 cut(s) 110
PsuI RGATCY 1 cut(s) 54
PvuII CAGCTG 1 cut(s) 249
SaqAI TTAA 1 cut(s) 307
Sau3AI GATC 1 cut(s) 54
Sau96I GGNCC 2 cut(s) 110, 177
ScrFI CCNGG 2 cut(s) 108, 192
SetI ASST 5 cut(s) 112, 166, 251, 258, 385
SfaNI GCATC 3 cut(s) 29, 107, 212
SinI GGWCC 1 cut(s) 110
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 2 cut(s) 91, 232
SsiI CCGC 2 cut(s) 169, 324
StyD4I CCNGG 2 cut(s) 106, 190
TaaI ACNGT 1 cut(s) 218
TaqI TCGA 2 cut(s) 65, 135
TasI AATT 2 cut(s) 91, 232
TfiI GAWTC 1 cut(s) 261
Tru1I TTAA 1 cut(s) 307
Tru9I TTAA 1 cut(s) 307
TscAI CASTG 2 cut(s) 56, 305
TseFI GTSAC 1 cut(s) 164
Tsp45I GTSAC 1 cut(s) 164
TspDTI ATGAA 1 cut(s) 358
TspRI CASTG 2 cut(s) 56, 305
VpaK11BI GGWCC 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.