Rmu_sc0005100.1_g000010

mRNA-binding protein involved in proper cytoplasmic distribution of mitochondria

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005100.1
Physical Location & Seq
Forward (+)
49597 .. 58464
8868 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005100.1_g000010.1.cds

Sequence Viewer

Length: 3265 bp
atgttttatgtcaattcaagctccgtaaataatacccttaatcccaggccaagcaaaagttatccagaagcgaccacacttgtcgggattttgcaaaagatcagctctaagttccaaaaagcttttcgtgaaattttggagcggagagcttctgcacatccttttgaaaacgtgcaatctctgttaccaccaaattcatggttagggttacatccagttccagatcacaaacgtgatgcagccagagcagaggatgcactgaccctctcttatggtagtgagctaattggtatgcaaagggattggaatgaggagttgcaatcttgtagggaatttccacatacaactcctcaggaaagaattttgcgggatagggctctctacaaagtgacatcagacttcgtggatgcagcaatcagtggtgctgttggagttatcagcagatgcataccacctataaatccaactgatcccgagtgcttccacatgtatgttcacaataacatcttcttcagtttcgctgttgatgcggatcttgagcagctgtctaagaaccatatgtcagtttccaatttgaaaatggggagcacaggctctctaggcagttcttctgaaaagtctactggcagtttgttgcatagagagagtgaaatcaccaatggggaaaaatgtgatgcgtcatgcgcaggggaatgccatgatgccatggaatcagctgctgagacacaattgggtgagactgagcaggctacttacgcttctgcaaataatgatttgaaaggcaccaaggcataccaggaagctgatgtccctggactttataatcttgctatggccataattgattacagaggccatagagtagtagctcagagtgttttgccaggcattcttcaaggggataaatcagactctcttttatatggttctgttgataatgggaaaaagatatgctggaatgaggattttcattccaaggtggtggaggctgctaaacgccttcatttgaaagaacacacagtcctcgatggatctggaaatgttttcaaattagctgcaccagtcgaatgcaagggtattgttggtagtgatgacaggcattatcttcttgacttgatgagagtaactcctcgtgatgcaaacttcactggatctgggtctcgattttgtatcttgagaccagaactaattacttcctattgccaggtccttgatgcagagaaatcaaaatcgaagtctaaatgtgaaggagaggctcaggtcaccgctgatgggccaaacgataaccaggacatcgcacaaaaagagaagaccgttgatgcacaagaaattgtctcaccaccagctgaaagctctgaatcacatgaggaaactcttttcaaccctaatgtcttcactgagtttaagttggctggaaatgcggaggagatagcaacagatgaagaaaatgtgaggaaagccagtttgtatcttactgaggttgttcttccgaagttcatacaagatctttgcacacttgaagtatcacccatggatgggcagacactaactgaagcactccatgctcatggaattaatgttcgttatattggaaaagtggctgatgggaccaggcatttacctcatctttgggatctttgttctaatgagattgtggttagatcagccaagcacattcttaaggatgtcttaagagatacagaggatcatgatattgggcctgcaatctgccatttcttcaactgttttttcggaagctatcaagctgttggctcaaaagtcgctgctaatagttctcagtctagaacccccaaaaaagaacaagcaggtcatcaatctccgggaaaacggtcaaagggacaaggaagatggaaggctggagcttctacaaggaagagtgtatcttcatatatgcatgttagctcagagactctatggtctgacattcaagaatttgccaaactcaaatatgagtttgagttgccaaaggatgctaggatgcatgtaaagaaagattcggttatccgtaatctttgccaaaaggtgggcattacaattgcagctcgcagatatgatctgaaatctgcagcaccttttgaaatatcagatatcttgaatcttcaacctgtagtgaaacactctgttcctgtttgttcagaagctaaggatcttgtggaaacagggaaaatccaattggctgagggaatgttgagtgaagcctacacattattttccgaggccttttccatacttcagcaggttacaggcccaatgcatcgggaggttgctaactgctgtcggtatcttgcaatggttctatatcatgctggagacatggcgggagccataatgcaacagcacaaggagctaattataaacgagcgttgcctgggtttggaccaccctgacactgctcacagctatgggaatatggctcttttctatcatggacttaaccaaacagaactcgccttacgacatatgtcccgggcattgctcctgttaagtttgtcatctggcccagatcatcctgatgttgcagcaacattcattaatgttgctatgatgtaccaggatcttgggaagatggacactgctcttcgatatttgcaagaggctttgaaaaagaatgaaaggcttctgggcgaggaacatatccaaactgctgtatgctatcatgcacttgctattgcatttaattgtatgggtgccttcaagctctcccaccagcatgagaagaaaacttatgatatacttgtcaaacaactgggtgaggaggattcgaggacacgtgactctcaaaactggatgaagacatttaagttgcgcgagcaacagatgaatgcacaaaagcaaaaaggtcaagctttgaatgccgcttcagctcaaaaggcaatcgacatgttaaaggccaatcctgacttgatgcaggcattccaatctgctgctatagccggcgggtctgggagttccaacacttctgtcaacaaatctcttaatgctgccgcaataatgggtgaaactcttccccgagggaggggagtagatgagagggctaaacgagcagcagccgaaatcaggaagaaggcagcagcgagaggcctcttaatacgtcaacacggtgttccggtccaagctctgcctccactgactcatctcctcaatatcatgagtgcagcaggtggggccccagattcagtggaaaatggagaaaccaatggagcgaaggaaggcaacaaccatccttcaaatggcccagcagatg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

1088

Amino Acids

119.6

Weight (kDa)

6.28

Isoelectric Point (pI)

44.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 822, 2375
AarI CACCTGC 1 cut(s) 3170
AasI GACNNNNNNGTC 1 cut(s) 1936
Acc16I TGCGCA 1 cut(s) 685
Acc36I ACCTGC 3 cut(s) 1817, 2248, 3170
AccB1I GGYRCC 2 cut(s) 782, 2708
AccB7I CCANNNNNTGG 1 cut(s) 2044
AccBSI CCGCTC 1 cut(s) 142
AccI GTMKAC 1 cut(s) 620
AccII CGCG 1 cut(s) 2829
AciI CCGC 9 cut(s) 142, 367, 530, 1266, 1421, 2339, 2877, 2958, 3006
AclWI GGATC 8 cut(s) 464, 540, 1039, 1159, 1641, 1713, 2175, 2583
AcoI YGGCCR 1 cut(s) 834
AcsI RAATTY 5 cut(s) 132, 193, 332, 360, 1952
AcuI CTGAAG 4 cut(s) 496, 1572, 2237, 2865
AcvI CACGTG 1 cut(s) 2792
AfaI GTAC 1 cut(s) 2570
AfiI CCNNNNNNNGG 9 cut(s) 1272, 1535, 1536, 2044, 2395, 3036, 3037, 3078, 3251
AflII CTTAAG 2 cut(s) 1679, 1690
AflIII ACRYGT 3 cut(s) 486, 2789, 2901
AjnI CCWGG 9 cut(s) 44, 795, 811, 883, 1203, 1287, 1610, 2388, 2571
AjuI GAANNNNNNNTTGG 4 cut(s) 108, 140, 2177, 2209
AleI CACNNNNGTG 1 cut(s) 231
AloI GAACNNNNNNTCC 4 cut(s) 1005, 1037, 1563, 1595
Alw21I GWGCWC 1 cut(s) 590
Alw26I GTCTC 7 cut(s) 716, 731, 1164, 1171, 1339, 1922, 2325
AlwI GGATC 8 cut(s) 464, 540, 1039, 1159, 1641, 1713, 2175, 2583
AlwNI CAGNNNCTG 1 cut(s) 719
Ama87I CYCGRG 3 cut(s) 473, 2487, 3030
ApaI GGGCCC 1 cut(s) 3190
ApoI RAATTY 5 cut(s) 132, 193, 332, 360, 1952
ArsI GACNNNNNNTTYG 2 cut(s) 1220, 1252
AseI ATTAAT 2 cut(s) 1575, 2553
Asp700I GAANNNNTTC 2 cut(s) 2637, 3024
AspLEI GCGC 2 cut(s) 686, 2829
AsuC2I CCSGG 3 cut(s) 1842, 2488, 2489
AsuHPI GGTGA 7 cut(s) 646, 746, 1255, 1329, 1518, 2783, 3029
AvaI CYCGRG 3 cut(s) 473, 2487, 3030
AvaII GGWCC 4 cut(s) 1207, 1608, 2398, 3130
AxyI CCTNAGG 1 cut(s) 351
BaeGI GKGCMC 1 cut(s) 3190
BalI TGGCCA 1 cut(s) 836
BanI GGYRCC 2 cut(s) 782, 2708
BanII GRGCYC 2 cut(s) 379, 3190
BauI CACGAG 1 cut(s) 1131
BbrPI CACGTG 1 cut(s) 2792
BbsI GAAGAC 3 cut(s) 1316, 1384, 2819
Bbv12I GWGCWC 1 cut(s) 590
BbvCI CCTCAGC 1 cut(s) 2199
BccI CCATC 7 cut(s) 1022, 1265, 1529, 1598, 1863, 2581, 3249
BciT130I CCWGG 9 cut(s) 46, 797, 813, 885, 1205, 1289, 1612, 2390, 2573
BcnI CCSGG 3 cut(s) 1842, 2488, 2489
BcoDI GTCTC 7 cut(s) 716, 731, 1164, 1171, 1339, 1922, 2325
BfaI CTAG 3 cut(s) 599, 1803, 1995
BfmI CTRYAG 3 cut(s) 2085, 2127, 2949
BfrI CTTAAG 2 cut(s) 1679, 1690
BfuAI ACCTGC 3 cut(s) 1817, 2248, 3170
BglII AGATCT 1 cut(s) 1504
Bme18I GGWCC 4 cut(s) 1207, 1608, 2398, 3130
BmeT110I CYCGRG 3 cut(s) 473, 2487, 3030
BmiI GGNNCC 7 cut(s) 784, 1609, 2344, 2710, 3187, 3188, 3189
BmrI ACTGGG 1 cut(s) 2777
BmuI ACTGGG 1 cut(s) 2777
BoxI GACNNNNGTC 1 cut(s) 2482
BpiI GAAGAC 3 cut(s) 1316, 1384, 2819
BplI GAGNNNNNCTC 2 cut(s) 1111, 1143
BpmI CTGGAG 2 cut(s) 1899, 2349
Bpu10I CCTNAGC 3 cut(s) 1257, 2163, 2199
BpuEI CTTGAG 2 cut(s) 557, 1195
BpuMI CCSGG 3 cut(s) 1842, 2488, 2489
BsaAI YACGTR 1 cut(s) 2792
BsaBI GATNNNNATC 1 cut(s) 531
BsaI GGTCTC 2 cut(s) 1164, 1171
BsaWI WCCGGW 1 cut(s) 3127
Bsc4I CCNNNNNNNGG 9 cut(s) 1272, 1535, 1536, 2044, 2395, 3036, 3037, 3078, 3251
Bse118I RCCGGY 1 cut(s) 2954
Bse1I ACTGG 7 cut(s) 215, 628, 1061, 1153, 1461, 2772, 2810
Bse21I CCTNAGG 1 cut(s) 351
Bse3DI GCAATG 2 cut(s) 2316, 2492
Bse8I GATNNNNATC 1 cut(s) 531
BseBI CCWGG 9 cut(s) 46, 797, 813, 885, 1205, 1289, 1612, 2390, 2573
BseJI GATNNNNATC 1 cut(s) 531
BseLI CCNNNNNNNGG 9 cut(s) 1272, 1535, 1536, 2044, 2395, 3036, 3037, 3078, 3251
BseMI GCAATG 2 cut(s) 2316, 2492
BseNI ACTGG 7 cut(s) 215, 628, 1061, 1153, 1461, 2772, 2810
BseRI GAGGAG 6 cut(s) 326, 339, 1119, 1439, 2789, 3149
BseSI GKGCMC 1 cut(s) 3190
BseYI CCCAGC 1 cut(s) 3256
BsgI GTGCAG 3 cut(s) 138, 1041, 3195
Bsh1236I CGCG 1 cut(s) 2829
BshNI GGYRCC 2 cut(s) 782, 2708
BsiHKAI GWGCWC 1 cut(s) 590
BsiHKCI CYCGRG 3 cut(s) 473, 2487, 3030
BsiSI CCGG 4 cut(s) 1841, 2488, 2955, 3128
BslFI GGGAC 4 cut(s) 794, 1621, 1872, 2470
BslI CCNNNNNNNGG 9 cut(s) 1272, 1535, 1536, 2044, 2395, 3036, 3037, 3078, 3251
BsmAI GTCTC 7 cut(s) 716, 731, 1164, 1171, 1339, 1922, 2325
BsmFI GGGAC 4 cut(s) 794, 1621, 1872, 2470
BsmI GAATGC 6 cut(s) 698, 888, 1073, 2848, 2878, 2933
Bso31I GGTCTC 2 cut(s) 1164, 1171
BsoBI CYCGRG 3 cut(s) 473, 2487, 3030
Bsp120I GGGCCC 1 cut(s) 3186
Bsp1286I GDGCHC 3 cut(s) 379, 590, 3190
Bsp19I CCATGG 2 cut(s) 705, 1530
BspACI CCGC 9 cut(s) 142, 367, 530, 1266, 1421, 2339, 2877, 2958, 3006
BspFNI CGCG 1 cut(s) 2829
BspHI TCATGA 2 cut(s) 1708, 3168
BspLI GGNNCC 7 cut(s) 784, 1609, 2344, 2710, 3187, 3188, 3189
BspMAI CTGCAG 1 cut(s) 2089
BspMI ACCTGC 3 cut(s) 1817, 2248, 3170
BspPI GGATC 8 cut(s) 464, 540, 1039, 1159, 1641, 1713, 2175, 2583
BspQI GCTCTTC 1 cut(s) 2604
BspT107I GGYRCC 2 cut(s) 782, 2708
BspTI CTTAAG 2 cut(s) 1679, 1690
BspTNI GGTCTC 2 cut(s) 1164, 1171
BsrBI CCGCTC 1 cut(s) 142
BsrDI GCAATG 2 cut(s) 2316, 2492
BsrFI RCCGGY 1 cut(s) 2954
BsrI ACTGG 7 cut(s) 215, 628, 1061, 1153, 1461, 2772, 2810
BssAI RCCGGY 1 cut(s) 2954
BssSI CACGAG 1 cut(s) 1131
BssT1I CCWWGG 4 cut(s) 705, 786, 975, 1530
Bst2BI CACGAG 1 cut(s) 1131
Bst2UI CCWGG 9 cut(s) 46, 797, 813, 885, 1205, 1289, 1612, 2390, 2573
Bst4CI ACNGT 5 cut(s) 1021, 1315, 1745, 1851, 3122
Bst6I CTCTTC 3 cut(s) 1889, 2604, 3030
BstAFI CTTAAG 2 cut(s) 1679, 1690
BstAPI GCANNNNNTGC 2 cut(s) 254, 1562
BstBAI YACGTR 1 cut(s) 2792
BstC8I GCNNGC 6 cut(s) 747, 1722, 2065, 2831, 2931, 2956
BstDSI CCRYGG 2 cut(s) 705, 1530
BstEII GGTNACC 1 cut(s) 1261
BstFNI CGCG 1 cut(s) 2829
BstHHI GCGC 2 cut(s) 686, 2829
BstMAI GTCTC 7 cut(s) 716, 731, 1164, 1171, 1339, 1922, 2325
BstNI CCWGG 9 cut(s) 46, 797, 813, 885, 1205, 1289, 1612, 2390, 2573
BstNSI RCATGY 4 cut(s) 490, 1919, 2006, 2905
BstPAI GACNNNNGTC 1 cut(s) 2482
BstPI GGTNACC 1 cut(s) 1261
BstSFI CTRYAG 3 cut(s) 2085, 2127, 2949
BstSLI GKGCMC 1 cut(s) 3190
BstUI CGCG 1 cut(s) 2829
BstV2I GAAGAC 3 cut(s) 1316, 1384, 2819
BstX2I RGATCY 7 cut(s) 532, 1031, 1151, 1504, 1633, 2167, 2575
BstXI CCANNNNNNTGG 4 cut(s) 198, 982, 1568, 2579
BstYI RGATCY 7 cut(s) 532, 1031, 1151, 1504, 1633, 2167, 2575
Bsu36I CCTNAGG 1 cut(s) 351
BtgI CCRYGG 2 cut(s) 705, 1530
BtgZI GCGATG 1 cut(s) 1279
BtsI GCAGTG 2 cut(s) 2409, 2592
BtsIMutI CAGTG 8 cut(s) 257, 424, 1146, 1395, 2409, 2592, 3146, 3204
BveI ACCTGC 3 cut(s) 1817, 2248, 3170
Cac8I GCNNGC 6 cut(s) 747, 1722, 2065, 2831, 2931, 2956
CaiI CAGNNNCTG 1 cut(s) 719
CciI TCATGA 2 cut(s) 1708, 3168
CfoI GCGC 2 cut(s) 686, 2829
Cfr10I RCCGGY 1 cut(s) 2954
Cfr9I CCCGGG 1 cut(s) 2487
CseI GACGC 1 cut(s) 666
Csp6I GTAC 1 cut(s) 2569
CviQI GTAC 1 cut(s) 2569
DrdI GACNNNNNNGTC 1 cut(s) 1936
DseDI GACNNNNNNGTC 1 cut(s) 1936
EaeI YGGCCR 1 cut(s) 834
Eam1104I CTCTTC 3 cut(s) 1889, 2604, 3030
EarI CTCTTC 3 cut(s) 1889, 2604, 3030
Eco130I CCWWGG 4 cut(s) 705, 786, 975, 1530
Eco147I AGGCCT 2 cut(s) 2240, 3102
Eco24I GRGCYC 2 cut(s) 379, 3190
Eco31I GGTCTC 2 cut(s) 1164, 1171
Eco32I GATATC 1 cut(s) 2110
Eco47I GGWCC 4 cut(s) 1207, 1608, 2398, 3130
Eco57I CTGAAG 4 cut(s) 496, 1572, 2237, 2865
Eco72I CACGTG 1 cut(s) 2792
Eco81I CCTNAGG 1 cut(s) 351
Eco88I CYCGRG 3 cut(s) 473, 2487, 3030
Eco91I GGTNACC 1 cut(s) 1261
EcoO109I RGGNCCY 3 cut(s) 1207, 3186, 3187
EcoO65I GGTNACC 1 cut(s) 1261
EcoRII CCWGG 9 cut(s) 44, 795, 811, 883, 1203, 1287, 1610, 2388, 2571
EcoRV GATATC 1 cut(s) 2110
EcoT14I CCWWGG 4 cut(s) 705, 786, 975, 1530
EcoT22I ATGCAT 4 cut(s) 449, 1917, 2004, 2277
EcoT38I GRGCYC 2 cut(s) 379, 3190
ErhI CCWWGG 4 cut(s) 705, 786, 975, 1530
FalI AAGNNNNNCTT 2 cut(s) 1673, 1705
FaqI GGGAC 4 cut(s) 794, 1621, 1872, 2470
FauI CCCGC 3 cut(s) 360, 2332, 2951
FauNDI CATATG 2 cut(s) 558, 2481
FblI GTMKAC 1 cut(s) 620
FriOI GRGCYC 2 cut(s) 379, 3190
FspBI CTAG 3 cut(s) 599, 1803, 1995
FspI TGCGCA 1 cut(s) 685
GlaI GCGC 2 cut(s) 685, 2828
GsaI CCCAGC 1 cut(s) 3260
GsuI CTGGAG 2 cut(s) 1899, 2349
HapII CCGG 4 cut(s) 1841, 2488, 2955, 3128
HgaI GACGC 1 cut(s) 666
HhaI GCGC 2 cut(s) 686, 2829
Hin6I GCGC 2 cut(s) 684, 2827
HinP1I GCGC 2 cut(s) 684, 2827
HincII GTYRAC 2 cut(s) 2986, 3116
HindII GTYRAC 2 cut(s) 2986, 3116
HindIII AAGCTT 2 cut(s) 120, 2865
HpaII CCGG 4 cut(s) 1841, 2488, 2955, 3128
HphI GGTGA 7 cut(s) 646, 746, 1255, 1329, 1518, 2783, 3029
Hpy166II GTNNAC 4 cut(s) 496, 621, 2986, 3116
Hpy8I GTNNAC 4 cut(s) 496, 621, 2986, 3116
HpyAV CCTTC 8 cut(s) 1010, 1241, 1867, 2722, 3079, 3220, 3224, 3255
HpyCH4III ACNGT 5 cut(s) 1021, 1315, 1745, 1851, 3122
HpyCH4IV ACGT 4 cut(s) 171, 232, 2791, 3112
HpySE526I ACGT 4 cut(s) 171, 232, 2791, 3112
HspAI GCGC 2 cut(s) 684, 2827
KroI GCCGGC 1 cut(s) 2954
KroNI GCCGGC 1 cut(s) 2956
LguI GCTCTTC 1 cut(s) 2604
LmnI GCTCC 8 cut(s) 26, 139, 585, 1880, 2342, 2365, 2502, 3221
MaeI CTAG 3 cut(s) 599, 1803, 1995
MaeII ACGT 4 cut(s) 171, 232, 2791, 3112
MaeIII GTNAC 7 cut(s) 183, 207, 388, 1123, 1261, 2260, 2792
MbiI CCGCTC 1 cut(s) 142
MfeI CAATTG 3 cut(s) 728, 2055, 2192
MflI RGATCY 7 cut(s) 532, 1031, 1151, 1504, 1633, 2167, 2575
MhlI GDGCHC 3 cut(s) 379, 590, 3190
MlsI TGGCCA 1 cut(s) 836
MluNI TGGCCA 1 cut(s) 836
MlyI GAGTC 4 cut(s) 905, 1924, 2789, 3145
MmeI TCCRAC 3 cut(s) 409, 488, 2997
Mox20I TGGCCA 1 cut(s) 836
Mph1103I ATGCAT 4 cut(s) 449, 1917, 2004, 2277
MroNI GCCGGC 1 cut(s) 2954
MroXI GAANNNNTTC 2 cut(s) 2637, 3024
MscI TGGCCA 1 cut(s) 836
MslI CAYNNNNRTG 6 cut(s) 231, 489, 1566, 2421, 2532, 2730
Msp20I TGGCCA 1 cut(s) 836
MspA1I CMGCKG 4 cut(s) 544, 716, 1268, 1346
MspCI CTTAAG 2 cut(s) 1679, 1690
MspI CCGG 4 cut(s) 1841, 2488, 2955, 3128
MunI CAATTG 3 cut(s) 728, 2055, 2192
Mva1269I GAATGC 6 cut(s) 698, 888, 1073, 2848, 2878, 2933
MvaI CCWGG 9 cut(s) 46, 797, 813, 885, 1205, 1289, 1612, 2390, 2573
MvnI CGCG 1 cut(s) 2829
NaeI GCCGGC 1 cut(s) 2956
NciI CCSGG 3 cut(s) 1842, 2488, 2489
NcoI CCATGG 2 cut(s) 705, 1530
NdeI CATATG 2 cut(s) 558, 2481
NgoMIV GCCGGC 1 cut(s) 2954
NlaIV GGNNCC 7 cut(s) 784, 1609, 2344, 2710, 3187, 3188, 3189
NmuCI GTSAC 3 cut(s) 388, 1261, 2792
NsbI TGCGCA 1 cut(s) 685
NsiI ATGCAT 4 cut(s) 449, 1917, 2004, 2277
NspI RCATGY 4 cut(s) 490, 1919, 2006, 2905
OliI CACNNNNGTG 1 cut(s) 231
PagI TCATGA 2 cut(s) 1708, 3168
PaqCI CACCTGC 1 cut(s) 3170
PceI AGGCCT 2 cut(s) 2240, 3102
PciI ACATGT 2 cut(s) 486, 2901
PciSI GCTCTTC 1 cut(s) 2604
PctI GAATGC 6 cut(s) 698, 888, 1073, 2848, 2878, 2933
PdiI GCCGGC 1 cut(s) 2956
PdmI GAANNNNTTC 2 cut(s) 2637, 3024
PfeI GAWTC 6 cut(s) 710, 1358, 2015, 2116, 2780, 3194
PflMI CCANNNNNTGG 1 cut(s) 2044
PfoI TCCNGGA 1 cut(s) 1840
PleI GAGTC 4 cut(s) 905, 1924, 2789, 3145
PmaCI CACGTG 1 cut(s) 2792
PmlI CACGTG 1 cut(s) 2792
PpsI GAGTC 4 cut(s) 905, 1924, 2789, 3145
Ppu21I YACGTR 1 cut(s) 2792
PpuMI RGGWCCY 1 cut(s) 1207
PscI ACATGT 2 cut(s) 486, 2901
PshAI GACNNNNGTC 1 cut(s) 2482
PshBI ATTAAT 2 cut(s) 1575, 2553
PsiI TTATAA 2 cut(s) 822, 2375
Psp5II RGGWCCY 1 cut(s) 1207
Psp6I CCWGG 9 cut(s) 44, 795, 811, 883, 1203, 1287, 1610, 2388, 2571
PspCI CACGTG 1 cut(s) 2792
PspEI GGTNACC 1 cut(s) 1261
PspFI CCCAGC 1 cut(s) 3256
PspGI CCWGG 9 cut(s) 44, 795, 811, 883, 1203, 1287, 1610, 2388, 2571
PspN4I GGNNCC 7 cut(s) 784, 1609, 2344, 2710, 3187, 3188, 3189
PspOMI GGGCCC 1 cut(s) 3186
PspPPI RGGWCCY 1 cut(s) 1207
PsrI GAACNNNNNNTAC 2 cut(s) 2457, 2489
PstI CTGCAG 1 cut(s) 2089
PstNI CAGNNNCTG 1 cut(s) 719
PsuI RGATCY 7 cut(s) 532, 1031, 1151, 1504, 1633, 2167, 2575
PvuII CAGCTG 3 cut(s) 544, 716, 1346
RsaI GTAC 1 cut(s) 2570
RsaNI GTAC 1 cut(s) 2569
RseI CAYNNNNRTG 6 cut(s) 231, 489, 1566, 2421, 2532, 2730
SapI GCTCTTC 1 cut(s) 2604
SchI GAGTC 4 cut(s) 905, 1924, 2789, 3145
SduI GDGCHC 3 cut(s) 379, 590, 3190
SfcI CTRYAG 3 cut(s) 2085, 2127, 2949
SinI GGWCC 4 cut(s) 1207, 1608, 2398, 3130
SmaI CCCGGG 1 cut(s) 2489
SmiMI CAYNNNNRTG 6 cut(s) 231, 489, 1566, 2421, 2532, 2730
SmlI CTYRAG 4 cut(s) 536, 1174, 1679, 1690
SmoI CTYRAG 4 cut(s) 536, 1174, 1679, 1690
SseBI AGGCCT 2 cut(s) 2240, 3102
SsiI CCGC 9 cut(s) 142, 367, 530, 1266, 1421, 2339, 2877, 2958, 3006
SspMI CTAG 3 cut(s) 599, 1803, 1995
StuI AGGCCT 2 cut(s) 2240, 3102
StyI CCWWGG 4 cut(s) 705, 786, 975, 1530
TaaI ACNGT 5 cut(s) 1021, 1315, 1745, 1851, 3122
TaiI ACGT 4 cut(s) 174, 235, 2794, 3115
TaqI TCGA 7 cut(s) 1026, 1065, 1162, 1232, 2602, 2783, 2898
TauI GCSGC 2 cut(s) 2879, 3008
TfiI GAWTC 6 cut(s) 710, 1358, 2015, 2116, 2780, 3194
TscAI CASTG 8 cut(s) 264, 424, 1153, 1402, 2416, 2599, 3153, 3204
TseFI GTSAC 3 cut(s) 388, 1261, 2792
Tsp45I GTSAC 3 cut(s) 388, 1261, 2792
TspGWI ACGGA 2 cut(s) 13, 2015
TspMI CCCGGG 1 cut(s) 2487
TspRI CASTG 8 cut(s) 264, 424, 1153, 1402, 2416, 2599, 3153, 3204
Van91I CCANNNNNTGG 1 cut(s) 2044
Vha464I CTTAAG 2 cut(s) 1679, 1690
VpaK11BI GGWCC 4 cut(s) 1207, 1608, 2398, 3130
VspI ATTAAT 2 cut(s) 1575, 2553
XapI RAATTY 5 cut(s) 132, 193, 332, 360, 1952
XbaI TCTAGA 1 cut(s) 1802
XceI RCATGY 4 cut(s) 490, 1919, 2006, 2905
XcmI CCANNNNNNNNNTGG 3 cut(s) 195, 577, 3248
XmaI CCCGGG 1 cut(s) 2487
XmiI GTMKAC 1 cut(s) 620
XmnI GAANNNNTTC 2 cut(s) 2637, 3024
XspI CTAG 3 cut(s) 599, 1803, 1995
Zsp2I ATGCAT 4 cut(s) 449, 1917, 2004, 2277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.