Rmu_co8337509.1_g000001

Glycerophosphodiester phosphodiesterase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8337509.1
Physical Location & Seq
Reverse (-)
124 .. 587
464 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8337509.1_g000001.1.cds

Sequence Viewer

Length: 264 bp
atgtatgctgatgctagaaagaactctttggaagaagcagttaaggtgtgcttggcaggtggtttgcacggcattgtttcagaagtgagtgctatcttgggaaatccagaagctgtaaccaggattcaagggaaaaaactccacctgttaacttacggccaactaaataatattgtaaaggctgtgtacatgcaacttcagatgggtgtagacggagtgattgttgaccttgttcaagagatcacagaggcagtttgtgactga

Protein Analysis

87

Amino Acids

9.35

Weight (kDa)

5.22

Isoelectric Point (pI)

33.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 47
Acc36I ACCTGC 1 cut(s) 47
AccI GTMKAC 1 cut(s) 210
AcoI YGGCCR 1 cut(s) 157
AcuI CTGAAG 1 cut(s) 182
AfaI GTAC 1 cut(s) 188
AgsI TTSAA 2 cut(s) 128, 236
AjnI CCWGG 1 cut(s) 119
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
AlwNI CAGNNNCTG 1 cut(s) 113
AoxI GGCC 1 cut(s) 157
BccI CCATC 1 cut(s) 196
BceAI ACGGC 2 cut(s) 85, 172
BciT130I CCWGG 1 cut(s) 121
BfaI CTAG 1 cut(s) 15
BfuAI ACCTGC 1 cut(s) 47
Bme1390I CCNGG 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 121
BsaXI ACNNNNNCTCC 2 cut(s) 207, 237
BseBI CCWGG 1 cut(s) 121
BshFI GGCC 1 cut(s) 159
BsnI GGCC 1 cut(s) 159
Bsp1407I TGTACA 1 cut(s) 186
Bsp143I GATC 1 cut(s) 240
BspANI GGCC 1 cut(s) 159
BspMI ACCTGC 1 cut(s) 47
BsrGI TGTACA 1 cut(s) 186
BssMI GATC 1 cut(s) 240
Bst2UI CCWGG 1 cut(s) 121
BstAUI TGTACA 1 cut(s) 186
BstKTI GATC 1 cut(s) 243
BstMBI GATC 1 cut(s) 240
BstNI CCWGG 1 cut(s) 121
BstNSI RCATGY 1 cut(s) 193
BstSCI CCNGG 1 cut(s) 119
BsuRI GGCC 1 cut(s) 159
BveI ACCTGC 1 cut(s) 47
CaiI CAGNNNCTG 1 cut(s) 113
Csp6I GTAC 1 cut(s) 187
CviAII CATG 1 cut(s) 190
CviJI RGCY 3 cut(s) 113, 159, 182
CviKI_1 RGCY 3 cut(s) 113, 159, 182
CviQI GTAC 1 cut(s) 187
DpnI GATC 1 cut(s) 242
DpnII GATC 1 cut(s) 240
EaeI YGGCCR 1 cut(s) 157
Eco57I CTGAAG 1 cut(s) 182
EcoRII CCWGG 1 cut(s) 119
FaeI CATG 1 cut(s) 193
FaiI YATR 2 cut(s) 6, 191
FalI AAGNNNNNCTT 2 cut(s) 35, 67
FatI CATG 1 cut(s) 189
FblI GTMKAC 1 cut(s) 210
FspBI CTAG 1 cut(s) 15
HaeIII GGCC 1 cut(s) 159
Hin1II CATG 1 cut(s) 193
HincII GTYRAC 2 cut(s) 150, 226
HindII GTYRAC 2 cut(s) 150, 226
HinfI GANTC 1 cut(s) 124
HpaI GTTAAC 1 cut(s) 150
Hpy166II GTNNAC 4 cut(s) 150, 187, 211, 226
Hpy188I TCNGA 2 cut(s) 82, 201
Hpy188III TCNNGA 2 cut(s) 107, 236
Hpy8I GTNNAC 4 cut(s) 150, 187, 211, 226
HpyCH4V TGCA 2 cut(s) 67, 193
Hsp92II CATG 1 cut(s) 193
KspAI GTTAAC 1 cut(s) 150
Kzo9I GATC 1 cut(s) 240
LpnPI CCDG 5 cut(s) 42, 106, 120, 133, 158
MaeI CTAG 1 cut(s) 15
MaeIII GTNAC 2 cut(s) 115, 257
MalI GATC 1 cut(s) 242
MboI GATC 1 cut(s) 240
MboII GAAGA 1 cut(s) 44
MnlI CCTC 1 cut(s) 241
MseI TTAA 2 cut(s) 42, 149
MspR9I CCNGG 1 cut(s) 121
MvaI CCWGG 1 cut(s) 121
NdeII GATC 1 cut(s) 240
NlaIII CATG 1 cut(s) 193
NmuCI GTSAC 1 cut(s) 257
NspI RCATGY 1 cut(s) 193
PaqCI CACCTGC 1 cut(s) 47
PfeI GAWTC 1 cut(s) 124
Psp6I CCWGG 1 cut(s) 119
PspGI CCWGG 1 cut(s) 119
PstNI CAGNNNCTG 1 cut(s) 113
RsaI GTAC 1 cut(s) 188
RsaNI GTAC 1 cut(s) 187
SaqAI TTAA 2 cut(s) 42, 149
Sau3AI GATC 1 cut(s) 240
ScrFI CCNGG 1 cut(s) 121
SetI ASST 5 cut(s) 48, 61, 115, 147, 231
SspI AATATT 1 cut(s) 172
SspMI CTAG 1 cut(s) 15
StyD4I CCNGG 1 cut(s) 119
TatI WGTACW 1 cut(s) 186
TfiI GAWTC 1 cut(s) 124
Tru1I TTAA 2 cut(s) 42, 149
Tru9I TTAA 2 cut(s) 42, 149
TseFI GTSAC 1 cut(s) 257
Tsp45I GTSAC 1 cut(s) 257
TspGWI ACGGA 1 cut(s) 228
XceI RCATGY 1 cut(s) 193
XmiI GTMKAC 1 cut(s) 210
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.