Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8341637.1

Orthogroup ID

OG0003808

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 526

Gene Structure 525 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8341637.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 525 bp

atgcaggagggaaagcttgatgatttgatcagcagcttaccatttgaaatacagaaaagagtagtttccttgctgccattgaaggaagcagtaagaacaagcactctttctacattttggagaagcctctggtttccaattcagctaagcttggattttgatccaaacccattaaccaatgaagggtctggtcaagaaatcgaacaggttatgggcatgttcttgagatcttatgcatgtccagaaaaattggagctcaatctcaaagtccttggccatatcaataaagaattggttgtcaaagctaccaaaggggttgagcaagagcttcatgttgagttctttgaaactcagaatgttgcagcaaaaacctgtttgagccttcatagcaatccagcccaaaaatctagtttcttcggggtcaagcttcttcacctcagatcagtcacccatctttccaaacctttggtttctatgctgctttcaaattgtaatgttcttgaaagcttgaggcttgttaaatgt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box FBD

Protein Analysis

175

Amino Acids

19.74

Weight (kDa)

7.71

Isoelectric Point (pI)

46.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003808)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G39490
fragaria_vesca	FvH4_6g14500 FvH4_7g21530 FvH4_7g21530
malus_domestica	MD01G1122000.v1.1 MD04G1119300.v1.1 MD07G1191500.v1.1
prunus_persica	Prupe.6G249000_v2.0.a1 Prupe.6G249000_v2.0.a1 Prupe.6G249000_v2.0.a1 Prupe.6G249000_v2.0.a1
pyrus_communis	pycom07g18090
rosa_chinensis	RchiOBHm_Chr1g0365841 RchiOBHm_Chr3g0467581
rosa_laevigata	RLG00000024488 RLG00000027387
rosa_multiflora	Rmu_co8341637.1_g000001 Rmu_co8477843.1_g000001 Rmu_sc0011632.1_g000014 Rmu_sc0023137.1_g000002
rosa_roxburghii	Rroxscaffold_4G00290810 Rroxscaffold_6G00413570
rosa_rugosa	Rorug01G0325000 Rorug03G0088300
rosa_samantha	Rh1AG333900 Rh1BG294500 Rh1CG311200 Rh1DG326900 Rh3AG136300 Rh3BG158200 Rh3CG158000 Rh3DG158800
rosa_wichuraiana	Rw1G029620 Rw3G012940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	155
AcoI	YGGCCR	1 cut(s)	274
AfiI	CCNNNNNNNGG	1 cut(s)	183
AgsI	TTSAA	5 cut(s)	47, 82, 347, 486, 503
AluBI	AGCT	9 cut(s)	16, 36, 145, 150, 256, 305, 328, 427, 507
AluI	AGCT	9 cut(s)	16, 36, 145, 150, 256, 305, 328, 427, 507
Alw21I	GWGCWC	1 cut(s)	258
AlwI	GGATC	1 cut(s)	155
AoxI	GGCC	1 cut(s)	274
ApeKI	GCWGC	4 cut(s)	33, 73, 362, 478
AsuHPI	GGTGA	2 cut(s)	425, 439
BalI	TGGCCA	1 cut(s)	276
BanII	GRGCYC	1 cut(s)	258
Bbv12I	GWGCWC	1 cut(s)	258
BbvI	GCAGC	4 cut(s)	45, 60, 374, 465
BccI	CCATC	1 cut(s)	459
BclI	TGATCA	1 cut(s)	27
BfaI	CTAG	1 cut(s)	408
BglII	AGATCT	1 cut(s)	227
BisI	GCNGC	4 cut(s)	34, 74, 363, 479
BlpI	GCTNAGC	1 cut(s)	146
BlsI	GCNGC	4 cut(s)	35, 75, 364, 480
Bpu1102I	GCTNAGC	1 cut(s)	146
BpuEI	CTTGAG	1 cut(s)	244
BsaBI	GATNNNNATC	1 cut(s)	159
BsaJI	CCNNGG	1 cut(s)	271
Bsc4I	CCNNNNNNNGG	1 cut(s)	183
Bse8I	GATNNNNATC	1 cut(s)	159
BseDI	CCNNGG	1 cut(s)	271
BseJI	GATNNNNATC	1 cut(s)	159
BseLI	CCNNNNNNNGG	1 cut(s)	183
BseMII	CTCAG	2 cut(s)	365, 451
BseXI	GCAGC	4 cut(s)	45, 60, 374, 465
BshFI	GGCC	1 cut(s)	276
BsiHKAI	GWGCWC	1 cut(s)	258
BslI	CCNNNNNNNGG	1 cut(s)	183
BsnI	GGCC	1 cut(s)	276
Bsp1286I	GDGCHC	1 cut(s)	258
Bsp143I	GATC	4 cut(s)	27, 160, 227, 440
Bsp1720I	GCTNAGC	1 cut(s)	146
BspANI	GGCC	1 cut(s)	276
BspCNI	CTCAG	2 cut(s)	364, 450
BspPI	GGATC	1 cut(s)	155
BssECI	CCNNGG	1 cut(s)	271
BssMI	GATC	4 cut(s)	27, 160, 227, 440
BssT1I	CCWWGG	1 cut(s)	271
BstDEI	CTNAG	3 cut(s)	146, 351, 437
BstKTI	GATC	4 cut(s)	30, 163, 230, 443
BstMBI	GATC	4 cut(s)	27, 160, 227, 440
BstMWI	GCNNNNNNNGC	1 cut(s)	387
BstNSI	RCATGY	2 cut(s)	220, 240
BstV1I	GCAGC	4 cut(s)	45, 60, 374, 465
BstX2I	RGATCY	1 cut(s)	227
BstXI	CCANNNNNNTGG	1 cut(s)	466
BstYI	RGATCY	1 cut(s)	227
BsuRI	GGCC	1 cut(s)	276
CviAII	CATG	3 cut(s)	217, 237, 332
DdeI	CTNAG	3 cut(s)	146, 351, 437
DpnI	GATC	4 cut(s)	29, 162, 229, 442
DpnII	GATC	4 cut(s)	27, 160, 227, 440
EaeI	YGGCCR	1 cut(s)	274
Ecl136II	GAGCTC	1 cut(s)	256
Eco130I	CCWWGG	1 cut(s)	271
Eco24I	GRGCYC	1 cut(s)	258
Eco53kI	GAGCTC	1 cut(s)	256
EcoICRI	GAGCTC	1 cut(s)	256
EcoT14I	CCWWGG	1 cut(s)	271
EcoT22I	ATGCAT	1 cut(s)	238
EcoT38I	GRGCYC	1 cut(s)	258
ErhI	CCWWGG	1 cut(s)	271
FaeI	CATG	3 cut(s)	220, 240, 335
FaiI	YATR	8 cut(s)	212, 218, 234, 238, 279, 333, 387, 476
FatI	CATG	3 cut(s)	216, 236, 331
FbaI	TGATCA	1 cut(s)	27
Fnu4HI	GCNGC	4 cut(s)	34, 74, 363, 479
FriOI	GRGCYC	1 cut(s)	258
Fsp4HI	GCNGC	4 cut(s)	34, 74, 363, 479
FspBI	CTAG	1 cut(s)	408
GluI	GCNGC	4 cut(s)	34, 74, 363, 479
HaeIII	GGCC	1 cut(s)	276
Hin1II	CATG	3 cut(s)	220, 240, 335
HindIII	AAGCTT	4 cut(s)	14, 148, 425, 505
HphI	GGTGA	2 cut(s)	425, 439
Hpy188I	TCNGA	2 cut(s)	354, 440
Hpy188III	TCNNGA	4 cut(s)	194, 223, 242, 500
HpyAV	CCTTC	3 cut(s)	76, 176, 392
HpyCH4V	TGCA	3 cut(s)	4, 236, 362
HpyF10VI	GCNNNNNNNGC	1 cut(s)	387
HpyF3I	CTNAG	3 cut(s)	146, 351, 437
Hsp92II	CATG	3 cut(s)	220, 240, 335
Ksp22I	TGATCA	1 cut(s)	27
Kzo9I	GATC	4 cut(s)	27, 160, 227, 440
LmnI	GCTCC	1 cut(s)	253
LpnPI	CCDG	6 cut(s)	115, 174, 191, 255, 385, 408
Lsp1109I	GCAGC	4 cut(s)	45, 60, 374, 465
MaeI	CTAG	1 cut(s)	408
MaeIII	GTNAC	1 cut(s)	445
MalI	GATC	4 cut(s)	29, 162, 229, 442
MboI	GATC	4 cut(s)	27, 160, 227, 440
MboII	GAAGA	2 cut(s)	406, 422
MflI	RGATCY	1 cut(s)	227
MhlI	GDGCHC	1 cut(s)	258
MlsI	TGGCCA	1 cut(s)	276
MluCI	AATT	4 cut(s)	138, 248, 290, 487
MluNI	TGGCCA	1 cut(s)	276
MnlI	CCTC	3 cut(s)	137, 446, 504
Mox20I	TGGCCA	1 cut(s)	276
Mph1103I	ATGCAT	1 cut(s)	238
MscI	TGGCCA	1 cut(s)	276
MseI	TTAA	2 cut(s)	173, 519
Msp20I	TGGCCA	1 cut(s)	276
MwoI	GCNNNNNNNGC	1 cut(s)	387
NdeII	GATC	4 cut(s)	27, 160, 227, 440
NlaIII	CATG	3 cut(s)	220, 240, 335
NmuCI	GTSAC	1 cut(s)	445
NsiI	ATGCAT	1 cut(s)	238
NspI	RCATGY	2 cut(s)	220, 240
PkrI	GCNGC	4 cut(s)	35, 75, 364, 480
Psp124BI	GAGCTC	1 cut(s)	258
PsuI	RGATCY	1 cut(s)	227
SacI	GAGCTC	1 cut(s)	258
SaqAI	TTAA	2 cut(s)	173, 519
SatI	GCNGC	4 cut(s)	34, 74, 363, 479
Sau3AI	GATC	4 cut(s)	27, 160, 227, 440
SduI	GDGCHC	1 cut(s)	258
SmlI	CTYRAG	2 cut(s)	223, 508
SmoI	CTYRAG	2 cut(s)	223, 508
Sse9I	AATT	4 cut(s)	138, 248, 290, 487
SspMI	CTAG	1 cut(s)	408
SstI	GAGCTC	1 cut(s)	258
StyI	CCWWGG	1 cut(s)	271
TaqI	TCGA	1 cut(s)	201
TasI	AATT	4 cut(s)	138, 248, 290, 487
Tru1I	TTAA	2 cut(s)	173, 519
Tru9I	TTAA	2 cut(s)	173, 519
TseFI	GTSAC	1 cut(s)	445
TseI	GCWGC	4 cut(s)	33, 73, 362, 478
Tsp45I	GTSAC	1 cut(s)	445
TspDTI	ATGAA	3 cut(s)	195, 320, 374
XceI	RCATGY	2 cut(s)	220, 240
XspI	CTAG	1 cut(s)	408
Zsp2I	ATGCAT	1 cut(s)	238

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.