Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0023137.1

Orthogroup ID

OG0003808

Physical Location & Seq

Genomic Coordinates Forward (+)

3073 .. 4396

Gene Structure 1324 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0023137.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1107 bp

atggaggaaaagagagatttgtttggcagattaccaaacgatatcatttgccatatcatttcttttcttccttcagaatctgcattagaaaccagtttgatttcaagtagatggagaggtctatggaacacagctttggttcaacatgtagctatagatgaagttcctgatgcagttgctgagtttctatctcattttgacaaacttgatcccttgaggcaccccagaaggctaaagttgtacttcggcgaaggtagtgatgtgcttctagctaccattgcagccaatgataaacttcacttggatttttctatagggaaaaaggaggaggagtaccctccaaggcattttgatttgcagttgcagcttaaatgtgaccagaatgtccaaaaccttatagctcacccccaaccttgtgcctctactttctctgtcaaaaccctttatctgaaatcagtaaccaatgttgtcaatgaggcaatttcttctatgttttcgagtttagagtttcttgaacacttgaagatcattgaatgtgatgggttacaaagtttgcatatcgagtccagtccaaagctactcagcttaagcatctttgactgtcatcacctcaaatctctccacctcagaacctctaaacttcgatcctttcattatcgaggttttctccctaggatttggccagaacatcatttcaaccttgcagatgccatgcttgatttcagactaggccccggctacacaagtttcagcagtagcgactttgatccaatgttgttaaccctaaagaatgctcaggttcttaaattatgcagatggagttttcaggcactgatctggccattgatatcgcctctacaagcaaatttcatgttttataaagtgaaagagttatggtggattgataaggaggaagaaagttacgacagtgatgccttaatctcctttctgaaattgtgtcctgtcttggaaagactctttgtaaccaatgatcctgaaagctactgcataacaagcacagctccaacctcaaagatagtcaaaagccatacaaaattgggtgatctgaaagtgattaaggcccagttggtagagctgggaatctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box FBD

Protein Analysis

368

Amino Acids

42.21

Weight (kDa)

6.24

Isoelectric Point (pI)

45.22

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003808)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G39490
fragaria_vesca	FvH4_6g14500 FvH4_7g21530 FvH4_7g21530
malus_domestica	MD01G1122000.v1.1 MD04G1119300.v1.1 MD07G1191500.v1.1
prunus_persica	Prupe.6G249000_v2.0.a1 Prupe.6G249000_v2.0.a1 Prupe.6G249000_v2.0.a1 Prupe.6G249000_v2.0.a1
pyrus_communis	pycom07g18090
rosa_chinensis	RchiOBHm_Chr1g0365841 RchiOBHm_Chr3g0467581
rosa_laevigata	RLG00000024488 RLG00000027387
rosa_multiflora	Rmu_co8341637.1_g000001 Rmu_co8477843.1_g000001 Rmu_sc0011632.1_g000014 Rmu_sc0023137.1_g000002
rosa_roxburghii	Rroxscaffold_4G00290810 Rroxscaffold_6G00413570
rosa_rugosa	Rorug01G0325000 Rorug03G0088300
rosa_samantha	Rh1AG333900 Rh1BG294500 Rh1CG311200 Rh1DG326900 Rh3AG136300 Rh3BG158200 Rh3CG158000 Rh3DG158800
rosa_wichuraiana	Rw1G029620 Rw3G012940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	879
AasI	GACNNNNNNGTC	1 cut(s)	383
AccB1I	GGYRCC	1 cut(s)	219
AclWI	GGATC	4 cut(s)	203, 639, 761, 986
AcoI	YGGCCR	2 cut(s)	680, 839
AcsI	RAATTY	1 cut(s)	865
AcuI	CTGAAG	1 cut(s)	57
AfaI	GTAC	2 cut(s)	242, 335
AflII	CTTAAG	1 cut(s)	586
AflIII	ACRYGT	1 cut(s)	145
AgsI	TTSAA	6 cut(s)	105, 143, 515, 523, 533, 697
AjuI	GAANNNNNNNTTGG	2 cut(s)	119, 151
AlwI	GGATC	4 cut(s)	203, 639, 761, 986
AlwNI	CAGNNNCTG	3 cut(s)	80, 179, 832
AoxI	GGCC	4 cut(s)	680, 730, 839, 1080
ApeKI	GCWGC	2 cut(s)	281, 364
ApoI	RAATTY	1 cut(s)	865
AspA2I	CCTAGG	1 cut(s)	671
AspS9I	GGNCC	2 cut(s)	731, 1081
AsuC2I	CCSGG	1 cut(s)	735
AsuHPI	GGTGA	3 cut(s)	395, 599, 1073
AvrII	CCTAGG	1 cut(s)	671
BalI	TGGCCA	2 cut(s)	682, 841
BanI	GGYRCC	1 cut(s)	219
BbvI	GCAGC	2 cut(s)	293, 376
BccI	CCATC	3 cut(s)	105, 533, 810
BcgI	CGANNNNNNTGC	2 cut(s)	914, 948
BcnI	CCSGG	1 cut(s)	735
BfaI	CTAG	4 cut(s)	269, 672, 728, 1105
BfmI	CTRYAG	2 cut(s)	153, 312
BfrI	CTTAAG	1 cut(s)	586
BisI	GCNGC	2 cut(s)	282, 365
BlnI	CCTAGG	1 cut(s)	671
BlsI	GCNGC	2 cut(s)	283, 366
Bme1390I	CCNGG	1 cut(s)	735
BmgT120I	GGNCC	2 cut(s)	731, 1081
BmiI	GGNNCC	2 cut(s)	221, 733
BmrFI	CCNGG	1 cut(s)	735
BmrI	ACTGGG	1 cut(s)	1078
BmsI	GCATC	4 cut(s)	160, 600, 697, 922
BmuI	ACTGGG	1 cut(s)	1078
BplI	GAGNNNNNCTC	2 cut(s)	651, 683
Bpu10I	CCTNAGC	1 cut(s)	795
BpuEI	CTTGAG	1 cut(s)	235
BpuMI	CCSGG	1 cut(s)	735
BsaJI	CCNNGG	3 cut(s)	341, 671, 733
BsaXI	ACNNNNNCTCC	2 cut(s)	317, 347
Bse1I	ACTGG	3 cut(s)	93, 567, 1084
Bse3DI	GCAATG	1 cut(s)	276
BseDI	CCNNGG	3 cut(s)	341, 671, 733
BseMI	GCAATG	1 cut(s)	276
BseMII	CTCAG	4 cut(s)	171, 595, 640, 809
BseNI	ACTGG	3 cut(s)	93, 567, 1084
BseRI	GAGGAG	2 cut(s)	341, 344
BseXI	GCAGC	2 cut(s)	293, 376
BseYI	CCCAGC	1 cut(s)	1096
BshFI	GGCC	4 cut(s)	682, 732, 841, 1082
BshNI	GGYRCC	1 cut(s)	219
BsiSI	CCGG	1 cut(s)	735
BsmI	GAATGC	1 cut(s)	796
BsnI	GGCC	4 cut(s)	682, 732, 841, 1082
Bsp143I	GATC	7 cut(s)	208, 525, 644, 766, 834, 991, 1063
BspANI	GGCC	4 cut(s)	682, 732, 841, 1082
BspCNI	CTCAG	4 cut(s)	172, 594, 639, 808
BspLI	GGNNCC	2 cut(s)	221, 733
BspPI	GGATC	4 cut(s)	203, 639, 761, 986
BspT107I	GGYRCC	1 cut(s)	219
BspTI	CTTAAG	1 cut(s)	586
BsrDI	GCAATG	1 cut(s)	276
BsrI	ACTGG	3 cut(s)	93, 567, 1084
BssECI	CCNNGG	3 cut(s)	341, 671, 733
BssMI	GATC	7 cut(s)	208, 525, 644, 766, 834, 991, 1063
BssT1I	CCWWGG	2 cut(s)	341, 671
Bst4CI	ACNGT	2 cut(s)	602, 929
BstAFI	CTTAAG	1 cut(s)	586
BstDEI	CTNAG	4 cut(s)	180, 581, 626, 795
BstKTI	GATC	7 cut(s)	211, 528, 647, 769, 837, 994, 1066
BstMBI	GATC	7 cut(s)	208, 525, 644, 766, 834, 991, 1063
BstMWI	GCNNNNNNNGC	3 cut(s)	278, 364, 1014
BstNSI	RCATGY	1 cut(s)	149
BstSCI	CCNGG	1 cut(s)	733
BstSFI	CTRYAG	2 cut(s)	153, 312
BstV1I	GCAGC	2 cut(s)	293, 376
BsuRI	GGCC	4 cut(s)	682, 732, 841, 1082
BtsIMutI	CAGTG	2 cut(s)	830, 934
CaiI	CAGNNNCTG	3 cut(s)	80, 179, 832
Cfr13I	GGNCC	2 cut(s)	731, 1081
Csp6I	GTAC	2 cut(s)	241, 334
CviAII	CATG	3 cut(s)	146, 712, 871
CviQI	GTAC	2 cut(s)	241, 334
DdeI	CTNAG	4 cut(s)	180, 581, 626, 795
DpnI	GATC	7 cut(s)	210, 527, 646, 768, 836, 993, 1065
DpnII	GATC	7 cut(s)	208, 525, 644, 766, 834, 991, 1063
DrdI	GACNNNNNNGTC	1 cut(s)	383
DseDI	GACNNNNNNGTC	1 cut(s)	383
EaeI	YGGCCR	2 cut(s)	680, 839
Eco130I	CCWWGG	2 cut(s)	341, 671
Eco32I	GATATC	2 cut(s)	43, 849
Eco57I	CTGAAG	1 cut(s)	57
EcoO109I	RGGNCCY	1 cut(s)	731
EcoRV	GATATC	2 cut(s)	43, 849
EcoT14I	CCWWGG	2 cut(s)	341, 671
ErhI	CCWWGG	2 cut(s)	341, 671
FaeI	CATG	3 cut(s)	149, 715, 874
FalI	AAGNNNNNCTT	2 cut(s)	227, 259
FatI	CATG	3 cut(s)	145, 711, 870
Fnu4HI	GCNGC	2 cut(s)	282, 365
Fsp4HI	GCNGC	2 cut(s)	282, 365
FspBI	CTAG	4 cut(s)	269, 672, 728, 1105
GluI	GCNGC	2 cut(s)	282, 365
GsaI	CCCAGC	1 cut(s)	1100
HaeIII	GGCC	4 cut(s)	682, 732, 841, 1082
HapII	CCGG	1 cut(s)	735
Hin1II	CATG	3 cut(s)	149, 715, 874
HincII	GTYRAC	1 cut(s)	780
HindII	GTYRAC	1 cut(s)	780
HinfI	GANTC	4 cut(s)	77, 563, 975, 1101
HpaI	GTTAAC	1 cut(s)	780
HpaII	CCGG	1 cut(s)	735
HphI	GGTGA	3 cut(s)	395, 599, 1073
Hpy166II	GTNNAC	1 cut(s)	780
Hpy188I	TCNGA	6 cut(s)	76, 450, 629, 725, 951, 1068
Hpy188III	TCNNGA	3 cut(s)	167, 512, 995
Hpy8I	GTNNAC	1 cut(s)	780
HpyAV	CCTTC	3 cut(s)	81, 222, 245
HpyCH4III	ACNGT	2 cut(s)	602, 929
HpyCH4V	TGCA	9 cut(s)	83, 173, 281, 358, 364, 556, 704, 813, 1008
HpyF10VI	GCNNNNNNNGC	3 cut(s)	278, 364, 1014
HpyF3I	CTNAG	4 cut(s)	180, 581, 626, 795
Hsp92II	CATG	3 cut(s)	149, 715, 874
KspAI	GTTAAC	1 cut(s)	780
Kzo9I	GATC	7 cut(s)	208, 525, 644, 766, 834, 991, 1063
LmnI	GCTCC	1 cut(s)	1027
Lsp1109I	GCAGC	2 cut(s)	293, 376
LweI	GCATC	4 cut(s)	160, 600, 697, 922
MaeI	CTAG	4 cut(s)	269, 672, 728, 1105
MaeIII	GTNAC	5 cut(s)	374, 457, 543, 920, 982
MalI	GATC	7 cut(s)	210, 527, 646, 768, 836, 993, 1065
MboI	GATC	7 cut(s)	208, 525, 644, 766, 834, 991, 1063
MboII	GAAGA	4 cut(s)	59, 477, 535, 926
MlsI	TGGCCA	2 cut(s)	682, 841
MluCI	AATT	5 cut(s)	480, 806, 865, 953, 1055
MluNI	TGGCCA	2 cut(s)	682, 841
MlyI	GAGTC	2 cut(s)	572, 969
MmeI	TCCRAC	1 cut(s)	1049
Mox20I	TGGCCA	2 cut(s)	682, 841
MscI	TGGCCA	2 cut(s)	682, 841
MseI	TTAA	6 cut(s)	369, 587, 779, 804, 938, 1077
Msp20I	TGGCCA	2 cut(s)	682, 841
MspCI	CTTAAG	1 cut(s)	586
MspI	CCGG	1 cut(s)	735
MspR9I	CCNGG	1 cut(s)	735
Mva1269I	GAATGC	1 cut(s)	796
MwoI	GCNNNNNNNGC	3 cut(s)	278, 364, 1014
NciI	CCSGG	1 cut(s)	735
NdeII	GATC	7 cut(s)	208, 525, 644, 766, 834, 991, 1063
NlaIII	CATG	3 cut(s)	149, 715, 874
NlaIV	GGNNCC	2 cut(s)	221, 733
NmuCI	GTSAC	1 cut(s)	374
NspI	RCATGY	1 cut(s)	149
PciI	ACATGT	1 cut(s)	145
PctI	GAATGC	1 cut(s)	796
PfeI	GAWTC	2 cut(s)	77, 1101
PkrI	GCNGC	2 cut(s)	283, 366
PleI	GAGTC	2 cut(s)	571, 969
PpsI	GAGTC	2 cut(s)	571, 969
PscI	ACATGT	1 cut(s)	145
PsiI	TTATAA	1 cut(s)	879
PspFI	CCCAGC	1 cut(s)	1096
PspN4I	GGNNCC	2 cut(s)	221, 733
PspPI	GGNCC	2 cut(s)	731, 1081
PstNI	CAGNNNCTG	3 cut(s)	80, 179, 832
RsaI	GTAC	2 cut(s)	242, 335
RsaNI	GTAC	2 cut(s)	241, 334
SaqAI	TTAA	6 cut(s)	369, 587, 779, 804, 938, 1077
SatI	GCNGC	2 cut(s)	282, 365
Sau3AI	GATC	7 cut(s)	208, 525, 644, 766, 834, 991, 1063
Sau96I	GGNCC	2 cut(s)	731, 1081
SchI	GAGTC	2 cut(s)	572, 969
ScrFI	CCNGG	1 cut(s)	735
SfaNI	GCATC	4 cut(s)	160, 600, 697, 922
SfcI	CTRYAG	2 cut(s)	153, 312
SmlI	CTYRAG	2 cut(s)	214, 586
SmoI	CTYRAG	2 cut(s)	214, 586
Sse9I	AATT	5 cut(s)	480, 806, 865, 953, 1055
SspMI	CTAG	4 cut(s)	269, 672, 728, 1105
StyD4I	CCNGG	1 cut(s)	733
StyI	CCWWGG	2 cut(s)	341, 671
TaaI	ACNGT	2 cut(s)	602, 929
TaqI	TCGA	4 cut(s)	497, 561, 643, 658
TasI	AATT	5 cut(s)	480, 806, 865, 953, 1055
TatI	WGTACW	1 cut(s)	240
TfiI	GAWTC	2 cut(s)	77, 1101
Tru1I	TTAA	6 cut(s)	369, 587, 779, 804, 938, 1077
Tru9I	TTAA	6 cut(s)	369, 587, 779, 804, 938, 1077
TscAI	CASTG	2 cut(s)	837, 934
TseFI	GTSAC	1 cut(s)	374
TseI	GCWGC	2 cut(s)	281, 364
Tsp45I	GTSAC	1 cut(s)	374
TspDTI	ATGAA	3 cut(s)	174, 641, 859
TspRI	CASTG	2 cut(s)	837, 934
Vha464I	CTTAAG	1 cut(s)	586
XapI	RAATTY	1 cut(s)	865
XceI	RCATGY	1 cut(s)	149
XmaJI	CCTAGG	1 cut(s)	671
XspI	CTAG	4 cut(s)	269, 672, 728, 1105

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.