Rmu_co8359539.1_g000001

ribosomal protein L4

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8359539.1
OG0002609
Physical Location & Seq
Forward (+)
4 .. 766
763 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8359539.1_g000001.1.cds

Sequence Viewer

Length: 384 bp
atggctttatcggtttccagaaggcttctacgttcatttggttctgttttggcatcaggcagctatgactctccgagtatattatatccatcgtttcgcgcttctcatggggttatcttttcctctgaggaatcttcggctgttcccaagggttggtcatcttcttatgcttatcgaaggctttcaactctgactcctgaatcaagtggaggtgcatttccctctgatctattatccaaaaagcctgtggtagcgtcagcgcataaaatagatacctgcattaattgttttagagtggttttagtctggaaattttgccaatctactggcataaggttcaaagctgttgtccctgatcttgaacatagatctaaaagagaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L4

Protein Analysis

127

Amino Acids

13.93

Weight (kDa)

9.81

Isoelectric Point (pI)

66.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 284
AccB7I CCANNNNNTGG 1 cut(s) 153
AccII CGCG 1 cut(s) 99
AcsI RAATTY 1 cut(s) 311
AfiI CCNNNNNNNGG 1 cut(s) 153
AgsI TTSAA 3 cut(s) 186, 340, 362
AluBI AGCT 2 cut(s) 63, 344
AluI AGCT 2 cut(s) 63, 344
ApeKI GCWGC 1 cut(s) 60
ApoI RAATTY 1 cut(s) 311
ArsI GACNNNNNNTTYG 2 cut(s) 333, 365
AseI ATTAAT 1 cut(s) 282
Asp700I GAANNNNTTC 1 cut(s) 181
AspLEI GCGC 2 cut(s) 101, 262
BbvI GCAGC 1 cut(s) 72
BccI CCATC 1 cut(s) 97
BfuAI ACCTGC 1 cut(s) 284
BglII AGATCT 1 cut(s) 368
BisI GCNGC 1 cut(s) 61
BlsI GCNGC 1 cut(s) 62
BmsI GCATC 1 cut(s) 62
BsaJI CCNNGG 1 cut(s) 147
BsaXI ACNNNNNCTCC 2 cut(s) 178, 208
Bsc4I CCNNNNNNNGG 1 cut(s) 153
Bse1I ACTGG 1 cut(s) 331
BseDI CCNNGG 1 cut(s) 147
BseLI CCNNNNNNNGG 1 cut(s) 153
BseMII CTCAG 1 cut(s) 117
BseNI ACTGG 1 cut(s) 331
BseXI GCAGC 1 cut(s) 72
Bsh1236I CGCG 1 cut(s) 99
BslFI GGGAC 1 cut(s) 335
BslI CCNNNNNNNGG 1 cut(s) 153
BsmFI GGGAC 1 cut(s) 335
Bsp143I GATC 3 cut(s) 226, 355, 368
BspCNI CTCAG 1 cut(s) 118
BspFNI CGCG 1 cut(s) 99
BspMI ACCTGC 1 cut(s) 284
BsrI ACTGG 1 cut(s) 331
BssECI CCNNGG 1 cut(s) 147
BssMI GATC 3 cut(s) 226, 355, 368
BssT1I CCWWGG 1 cut(s) 147
BstDEI CTNAG 1 cut(s) 126
BstFNI CGCG 1 cut(s) 99
BstHHI GCGC 2 cut(s) 101, 262
BstKTI GATC 3 cut(s) 229, 358, 371
BstMBI GATC 3 cut(s) 226, 355, 368
BstUI CGCG 1 cut(s) 99
BstV1I GCAGC 1 cut(s) 72
BstX2I RGATCY 1 cut(s) 368
BstXI CCANNNNNNTGG 1 cut(s) 326
BstYI RGATCY 1 cut(s) 368
BveI ACCTGC 1 cut(s) 284
CfoI GCGC 2 cut(s) 101, 262
CseI GACGC 1 cut(s) 243
CviAII CATG 1 cut(s) 107
CviJI RGCY 7 cut(s) 5, 25, 63, 140, 181, 244, 344
CviKI_1 RGCY 7 cut(s) 5, 25, 63, 140, 181, 244, 344
DdeI CTNAG 1 cut(s) 126
DpnI GATC 3 cut(s) 228, 357, 370
DpnII GATC 3 cut(s) 226, 355, 368
Eco130I CCWWGG 1 cut(s) 147
EcoT14I CCWWGG 1 cut(s) 147
ErhI CCWWGG 1 cut(s) 147
FaeI CATG 1 cut(s) 110
FaiI YATR 8 cut(s) 66, 80, 85, 108, 168, 264, 332, 366
FaqI GGGAC 1 cut(s) 335
FatI CATG 1 cut(s) 106
Fnu4HI GCNGC 1 cut(s) 61
Fsp4HI GCNGC 1 cut(s) 61
GlaI GCGC 2 cut(s) 100, 261
GluI GCNGC 1 cut(s) 61
HgaI GACGC 1 cut(s) 243
HhaI GCGC 2 cut(s) 101, 262
Hin1II CATG 1 cut(s) 110
Hin6I GCGC 2 cut(s) 99, 260
HinP1I GCGC 2 cut(s) 99, 260
HinfI GANTC 4 cut(s) 68, 131, 193, 200
Hpy188I TCNGA 4 cut(s) 75, 127, 192, 226
Hpy188III TCNNGA 4 cut(s) 18, 197, 307, 359
HpyAV CCTTC 2 cut(s) 15, 171
HpyCH4IV ACGT 1 cut(s) 31
HpyCH4V TGCA 2 cut(s) 215, 279
HpyF3I CTNAG 1 cut(s) 126
HpySE526I ACGT 1 cut(s) 31
Hsp92II CATG 1 cut(s) 110
HspAI GCGC 2 cut(s) 99, 260
Kzo9I GATC 3 cut(s) 226, 355, 368
LpnPI CCDG 8 cut(s) 31, 42, 210, 258, 289, 292, 312, 366
Lsp1109I GCAGC 1 cut(s) 72
LweI GCATC 1 cut(s) 62
MaeII ACGT 1 cut(s) 31
MalI GATC 3 cut(s) 228, 357, 370
MboI GATC 3 cut(s) 226, 355, 368
MboII GAAGA 2 cut(s) 126, 153
MflI RGATCY 1 cut(s) 368
MluCI AATT 2 cut(s) 283, 311
MlyI GAGTC 2 cut(s) 62, 187
MnlI CCTC 4 cut(s) 121, 133, 203, 232
MroXI GAANNNNTTC 1 cut(s) 181
MseI TTAA 1 cut(s) 282
MvnI CGCG 1 cut(s) 99
NdeII GATC 3 cut(s) 226, 355, 368
NlaIII CATG 1 cut(s) 110
PdmI GAANNNNTTC 1 cut(s) 181
PfeI GAWTC 2 cut(s) 131, 200
PflMI CCANNNNNTGG 1 cut(s) 153
PkrI GCNGC 1 cut(s) 62
PleI GAGTC 2 cut(s) 62, 187
PpsI GAGTC 2 cut(s) 62, 187
PshBI ATTAAT 1 cut(s) 282
PsuI RGATCY 1 cut(s) 368
SaqAI TTAA 1 cut(s) 282
SatI GCNGC 1 cut(s) 61
Sau3AI GATC 3 cut(s) 226, 355, 368
SchI GAGTC 2 cut(s) 62, 187
SetI ASST 6 cut(s) 34, 65, 214, 278, 338, 346
SfaNI GCATC 1 cut(s) 62
Sse9I AATT 2 cut(s) 283, 311
StyI CCWWGG 1 cut(s) 147
TaiI ACGT 1 cut(s) 34
TaqI TCGA 1 cut(s) 175
TasI AATT 2 cut(s) 283, 311
TfiI GAWTC 2 cut(s) 131, 200
Tru1I TTAA 1 cut(s) 282
Tru9I TTAA 1 cut(s) 282
TseI GCWGC 1 cut(s) 60
TspDTI ATGAA 1 cut(s) 24
Van91I CCANNNNNTGG 1 cut(s) 153
VspI ATTAAT 1 cut(s) 282
XapI RAATTY 1 cut(s) 311
XcmI CCANNNNNNNNNTGG 1 cut(s) 244
XmnI GAANNNNTTC 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.