Rmu_co8373497.1_g000001

Palmitoyl-monogalactosyldiacylglycerol delta-7 desaturase, chloroplastic-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8373497.1
Physical Location & Seq
Forward (+)
628 .. 1074
447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8373497.1_g000001.1.cds

Sequence Viewer

Length: 336 bp
atggtaattgttttccacagcactttgctagtaaattcggctgggcacacatgggggtatcaagcatggaacaccggtgatctatctaagaacctttggtggttaggattgcttggactaggagaaggatggcacaacaaccaccacgctttcgaatactcggctcgacaaggcctcgaatggtggcagattgacatgacttggtacgtcataagatttcttgaagctctagggttggcaaaagatgtgaaactaccatctgaagctcacaagaaacgcaaagctttagagaccagaacaaccgtcgcttctcatgaaataagctacgaagattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

12.87

Weight (kDa)

6.36

Isoelectric Point (pI)

22.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 34
AcuI CTGAAG 1 cut(s) 282
AfaI GTAC 1 cut(s) 206
AgeI ACCGGT 1 cut(s) 74
AgsI TTSAA 1 cut(s) 224
AluBI AGCT 4 cut(s) 227, 266, 284, 324
AluI AGCT 4 cut(s) 227, 266, 284, 324
Alw26I GTCTC 1 cut(s) 284
AoxI GGCC 1 cut(s) 172
ApoI RAATTY 1 cut(s) 34
AsiGI ACCGGT 1 cut(s) 74
AsuHPI GGTGA 1 cut(s) 89
AsuII TTCGAA 1 cut(s) 153
BaeGI GKGCMC 1 cut(s) 48
BccI CCATC 2 cut(s) 123, 265
BcoDI GTCTC 1 cut(s) 284
BfaI CTAG 3 cut(s) 29, 119, 230
Bpu14I TTCGAA 1 cut(s) 153
BsaI GGTCTC 1 cut(s) 284
BsaWI WCCGGW 1 cut(s) 74
Bse118I RCCGGY 1 cut(s) 74
BseGI GGATG 1 cut(s) 134
BseSI GKGCMC 1 cut(s) 48
BseYI CCCAGC 1 cut(s) 41
BshFI GGCC 1 cut(s) 174
BshTI ACCGGT 1 cut(s) 74
BsiSI CCGG 1 cut(s) 75
BsmAI GTCTC 1 cut(s) 284
BsnI GGCC 1 cut(s) 174
Bso31I GGTCTC 1 cut(s) 284
Bsp119I TTCGAA 1 cut(s) 153
Bsp1286I GDGCHC 1 cut(s) 48
Bsp143I GATC 1 cut(s) 79
BspANI GGCC 1 cut(s) 174
BspHI TCATGA 1 cut(s) 313
BspT104I TTCGAA 1 cut(s) 153
BspTNI GGTCTC 1 cut(s) 284
BsrFI RCCGGY 1 cut(s) 74
BssAI RCCGGY 1 cut(s) 74
BssMI GATC 1 cut(s) 79
Bst4CI ACNGT 1 cut(s) 304
BstBI TTCGAA 1 cut(s) 153
BstDEI CTNAG 1 cut(s) 87
BstF5I GGATG 1 cut(s) 134
BstKTI GATC 1 cut(s) 82
BstMAI GTCTC 1 cut(s) 284
BstMBI GATC 1 cut(s) 79
BstSLI GKGCMC 1 cut(s) 48
BsuRI GGCC 1 cut(s) 174
BtsCI GGATG 1 cut(s) 134
CciI TCATGA 1 cut(s) 313
Cfr10I RCCGGY 1 cut(s) 74
Csp6I GTAC 1 cut(s) 205
CspAI ACCGGT 1 cut(s) 74
CviAII CATG 4 cut(s) 51, 66, 196, 314
CviJI RGCY 7 cut(s) 41, 164, 174, 227, 266, 284, 324
CviKI_1 RGCY 7 cut(s) 41, 164, 174, 227, 266, 284, 324
CviQI GTAC 1 cut(s) 205
DdeI CTNAG 1 cut(s) 87
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
Eco147I AGGCCT 1 cut(s) 174
Eco31I GGTCTC 1 cut(s) 284
Eco57I CTGAAG 1 cut(s) 282
FaeI CATG 4 cut(s) 54, 69, 199, 317
FaiI YATR 5 cut(s) 52, 67, 197, 212, 315
FatI CATG 4 cut(s) 50, 65, 195, 313
FokI GGATG 1 cut(s) 141
FspBI CTAG 3 cut(s) 29, 119, 230
GsaI CCCAGC 1 cut(s) 45
HaeIII GGCC 1 cut(s) 174
HapII CCGG 1 cut(s) 75
Hin1II CATG 4 cut(s) 54, 69, 199, 317
HindIII AAGCTT 1 cut(s) 282
HpaII CCGG 1 cut(s) 75
HphI GGTGA 1 cut(s) 89
Hpy188I TCNGA 1 cut(s) 262
Hpy188III TCNNGA 2 cut(s) 221, 314
Hpy99I CGWCG 1 cut(s) 308
HpyAV CCTTC 1 cut(s) 119
HpyCH4III ACNGT 1 cut(s) 304
HpyCH4IV ACGT 1 cut(s) 207
HpyF3I CTNAG 1 cut(s) 87
HpySE526I ACGT 1 cut(s) 207
Hsp92II CATG 4 cut(s) 54, 69, 199, 317
Kzo9I GATC 1 cut(s) 79
LpnPI CCDG 3 cut(s) 27, 88, 307
MaeI CTAG 3 cut(s) 29, 119, 230
MaeII ACGT 1 cut(s) 207
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MhlI GDGCHC 1 cut(s) 48
MluCI AATT 2 cut(s) 6, 34
MnlI CCTC 1 cut(s) 185
MseI TTAA 1 cut(s) 334
MspI CCGG 1 cut(s) 75
NdeII GATC 1 cut(s) 79
NlaIII CATG 4 cut(s) 54, 69, 199, 317
NmeAIII GCCGAG 1 cut(s) 140
NspV TTCGAA 1 cut(s) 153
PagI TCATGA 1 cut(s) 313
PceI AGGCCT 1 cut(s) 174
PinAI ACCGGT 1 cut(s) 74
PspFI CCCAGC 1 cut(s) 41
RsaI GTAC 1 cut(s) 206
RsaNI GTAC 1 cut(s) 205
SaqAI TTAA 1 cut(s) 334
Sau3AI GATC 1 cut(s) 79
SduI GDGCHC 1 cut(s) 48
SetI ASST 6 cut(s) 96, 210, 229, 268, 286, 326
SfuI TTCGAA 1 cut(s) 153
SgrAI CRCCGGYG 1 cut(s) 74
Sse9I AATT 2 cut(s) 6, 34
SseBI AGGCCT 1 cut(s) 174
SspMI CTAG 3 cut(s) 29, 119, 230
StuI AGGCCT 1 cut(s) 174
TaaI ACNGT 1 cut(s) 304
TaiI ACGT 1 cut(s) 210
TaqI TCGA 3 cut(s) 153, 166, 177
TasI AATT 2 cut(s) 6, 34
Tru1I TTAA 1 cut(s) 334
Tru9I TTAA 1 cut(s) 334
TspDTI ATGAA 1 cut(s) 330
XapI RAATTY 1 cut(s) 34
XspI CTAG 3 cut(s) 29, 119, 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.