Rh5CG004800

Palmitoyl-monogalactosyldiacylglycerol delta-7 desaturase, chloroplastic-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
324915 .. 336348
11434 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG004800.1

Sequence Viewer

Length: 267 bp
ATGAAGAACATGCTTCAGACACATGGGTTGTTCGCATTGCCTACACCTGGAGAAGGGTGGCACAATAACCACCACGCCTTTGATTACTCAGCTCAACAGGGCCTCGAATGGTGGCAGATTGATTTGACATGGTATTTGATCAGATTTCTTCAAGTTGATGGTTTGGCAACCGATGTGAAACCCCCAACTGAGAACCAGAAGAAACGAAAACCTTTGTACAACAAAACAAAAGAGCAAAAATTTGAAGAAAAAGTCTATTGCTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

10.46

Weight (kDa)

7.88

Isoelectric Point (pI)

33.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 239
AfaI GTAC 1 cut(s) 218
AfiI CCNNNNNNNGG 2 cut(s) 47, 53
AgsI TTSAA 2 cut(s) 152, 245
AjnI CCWGG 1 cut(s) 46
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
AoxI GGCC 1 cut(s) 100
ApoI RAATTY 1 cut(s) 239
ArsI GACNNNNNNTTYG 2 cut(s) 118, 150
AspS9I GGNCC 1 cut(s) 100
BccI CCATC 1 cut(s) 152
BciT130I CCWGG 1 cut(s) 48
BclI TGATCA 1 cut(s) 138
Bme1390I CCNGG 1 cut(s) 48
BmgT120I GGNCC 1 cut(s) 100
BmrFI CCNGG 1 cut(s) 48
BpmI CTGGAG 1 cut(s) 69
Bsc4I CCNNNNNNNGG 2 cut(s) 47, 53
Bse3DI GCAATG 1 cut(s) 35
BseBI CCWGG 1 cut(s) 48
BseLI CCNNNNNNNGG 2 cut(s) 47, 53
BseMI GCAATG 1 cut(s) 35
BseMII CTCAG 2 cut(s) 102, 180
BshFI GGCC 1 cut(s) 102
BslI CCNNNNNNNGG 2 cut(s) 47, 53
BsnI GGCC 1 cut(s) 102
Bsp1407I TGTACA 1 cut(s) 216
Bsp143I GATC 1 cut(s) 138
BspANI GGCC 1 cut(s) 102
BspCNI CTCAG 2 cut(s) 101, 181
BsrDI GCAATG 1 cut(s) 35
BsrGI TGTACA 1 cut(s) 216
BssMI GATC 1 cut(s) 138
Bst2UI CCWGG 1 cut(s) 48
BstAUI TGTACA 1 cut(s) 216
BstDEI CTNAG 2 cut(s) 88, 189
BstENI CCTNNNNNAGG 1 cut(s) 51
BstKTI GATC 1 cut(s) 141
BstMBI GATC 1 cut(s) 138
BstNI CCWGG 1 cut(s) 48
BstNSI RCATGY 1 cut(s) 13
BstSCI CCNGG 1 cut(s) 46
BsuRI GGCC 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 100
Csp6I GTAC 1 cut(s) 217
CviAII CATG 3 cut(s) 10, 23, 129
CviJI RGCY 2 cut(s) 92, 102
CviKI_1 RGCY 2 cut(s) 92, 102
CviQI GTAC 1 cut(s) 217
DdeI CTNAG 2 cut(s) 88, 189
DpnI GATC 1 cut(s) 140
DpnII GATC 1 cut(s) 138
EcoNI CCTNNNNNAGG 1 cut(s) 51
EcoO109I RGGNCCY 1 cut(s) 100
EcoRII CCWGG 1 cut(s) 46
FaeI CATG 3 cut(s) 13, 26, 132
FaiI YATR 3 cut(s) 11, 24, 130
FatI CATG 3 cut(s) 9, 22, 128
FbaI TGATCA 1 cut(s) 138
GsuI CTGGAG 1 cut(s) 69
HaeIII GGCC 1 cut(s) 102
Hin1II CATG 3 cut(s) 13, 26, 132
Hpy188I TCNGA 2 cut(s) 18, 143
Hpy188III TCNNGA 1 cut(s) 264
HpyAV CCTTC 1 cut(s) 47
HpyF3I CTNAG 2 cut(s) 88, 189
Hsp92II CATG 3 cut(s) 13, 26, 132
Ksp22I TGATCA 1 cut(s) 138
Kzo9I GATC 1 cut(s) 138
LpnPI CCDG 4 cut(s) 33, 60, 83, 209
MalI GATC 1 cut(s) 140
MboI GATC 1 cut(s) 138
MboII GAAGA 4 cut(s) 16, 140, 211, 257
MluCI AATT 1 cut(s) 239
MnlI CCTC 1 cut(s) 113
MspR9I CCNGG 1 cut(s) 48
MvaI CCWGG 1 cut(s) 48
NdeII GATC 1 cut(s) 138
NlaIII CATG 3 cut(s) 13, 26, 132
NspI RCATGY 1 cut(s) 13
Psp6I CCWGG 1 cut(s) 46
PspGI CCWGG 1 cut(s) 46
PspPI GGNCC 1 cut(s) 100
RsaI GTAC 1 cut(s) 218
RsaNI GTAC 1 cut(s) 217
Sau3AI GATC 1 cut(s) 138
Sau96I GGNCC 1 cut(s) 100
ScrFI CCNGG 1 cut(s) 48
SetI ASST 3 cut(s) 49, 94, 214
Sse9I AATT 1 cut(s) 239
StyD4I CCNGG 1 cut(s) 46
TaqI TCGA 1 cut(s) 105
TasI AATT 1 cut(s) 239
TatI WGTACW 1 cut(s) 216
TspDTI ATGAA 1 cut(s) 17
XagI CCTNNNNNAGG 1 cut(s) 51
XapI RAATTY 1 cut(s) 239
XceI RCATGY 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.