Rroxscaffold_2G00091620

Palmitoyl-monogalactosyldiacylglycerol delta-7 desaturase, chloroplastic-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
13130676 .. 13132571
1896 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00091620.1

Sequence Viewer

Length: 312 bp
ATGGGTGTGAGAACTGTATTTTTACTCCAGATTACTTTTTCAATAAACTCGATCTGCCACATATGGGGAAAGCAAGTATGGAATACTGGTGATTTGTCTAGAAACAACTGGTTGTTGGGGTTGCTAGCACTTGGCGAGGGTTGGCACAATAATCATCATGCATTTGAATACTCAGCTAGACAAGGCTTGGAATGGTGGGAGATTGACACTACTTGGTATATAATACGCTTCCTTGAAGCCATTGGTTTGGCTACAGACGTAAAACTCCCAACTGAAGCTCATAAAGAAACGAAAGGCTTTATGCAAGAATAG

Protein Analysis

103

Amino Acids

12.0

Weight (kDa)

5.91

Isoelectric Point (pI)

33.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FA_desaturase PF00487 7 - 76 2.1e-07 Fatty acid desaturase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 294
AfiI CCNNNNNNNGG 1 cut(s) 64
AgsI TTSAA 3 cut(s) 42, 167, 236
AluBI AGCT 2 cut(s) 176, 278
AluI AGCT 2 cut(s) 176, 278
AsuHPI GGTGA 1 cut(s) 101
AsuNHI GCTAGC 1 cut(s) 124
BfaI CTAG 3 cut(s) 99, 125, 177
BfmI CTRYAG 1 cut(s) 252
BmtI GCTAGC 1 cut(s) 128
BpmI CTGGAG 1 cut(s) 11
Bsc4I CCNNNNNNNGG 1 cut(s) 64
Bse1I ACTGG 2 cut(s) 91, 113
BseLI CCNNNNNNNGG 1 cut(s) 64
BseMII CTCAG 1 cut(s) 186
BseNI ACTGG 2 cut(s) 91, 113
BslI CCNNNNNNNGG 1 cut(s) 64
Bsp143I GATC 1 cut(s) 51
BspCNI CTCAG 1 cut(s) 185
BspOI GCTAGC 1 cut(s) 128
BsrI ACTGG 2 cut(s) 91, 113
BssMI GATC 1 cut(s) 51
Bst4CI ACNGT 1 cut(s) 16
BstC8I GCNNGC 1 cut(s) 126
BstDEI CTNAG 1 cut(s) 172
BstKTI GATC 1 cut(s) 54
BstMBI GATC 1 cut(s) 51
BstSFI CTRYAG 1 cut(s) 252
BstXI CCANNNNNNTGG 1 cut(s) 247
Cac8I GCNNGC 1 cut(s) 126
CviAII CATG 1 cut(s) 158
CviJI RGCY 6 cut(s) 176, 186, 239, 251, 278, 297
CviKI_1 RGCY 6 cut(s) 176, 186, 239, 251, 278, 297
DdeI CTNAG 1 cut(s) 172
DpnI GATC 1 cut(s) 53
DpnII GATC 1 cut(s) 51
Eco57I CTGAAG 1 cut(s) 294
EcoT22I ATGCAT 1 cut(s) 163
FaeI CATG 1 cut(s) 161
FaiI YATR 8 cut(s) 62, 64, 79, 159, 219, 221, 282, 302
FatI CATG 1 cut(s) 157
FauNDI CATATG 1 cut(s) 62
FspBI CTAG 3 cut(s) 99, 125, 177
GsuI CTGGAG 1 cut(s) 11
Hin1II CATG 1 cut(s) 161
HphI GGTGA 1 cut(s) 101
Hpy188III TCNNGA 2 cut(s) 28, 99
HpyCH4III ACNGT 1 cut(s) 16
HpyCH4IV ACGT 1 cut(s) 258
HpyCH4V TGCA 2 cut(s) 161, 304
HpyF3I CTNAG 1 cut(s) 172
HpySE526I ACGT 1 cut(s) 258
Hsp92II CATG 1 cut(s) 161
Kzo9I GATC 1 cut(s) 51
LpnPI CCDG 3 cut(s) 41, 72, 94
MaeI CTAG 3 cut(s) 99, 125, 177
MaeII ACGT 1 cut(s) 258
MalI GATC 1 cut(s) 53
MboI GATC 1 cut(s) 51
MnlI CCTC 1 cut(s) 130
Mph1103I ATGCAT 1 cut(s) 163
NdeI CATATG 1 cut(s) 62
NdeII GATC 1 cut(s) 51
NheI GCTAGC 1 cut(s) 124
NlaIII CATG 1 cut(s) 161
NsiI ATGCAT 1 cut(s) 163
Sau3AI GATC 1 cut(s) 51
SetI ASST 3 cut(s) 178, 261, 280
SfcI CTRYAG 1 cut(s) 252
SspMI CTAG 3 cut(s) 99, 125, 177
TaaI ACNGT 1 cut(s) 16
TaiI ACGT 1 cut(s) 261
TaqI TCGA 1 cut(s) 50
XbaI TCTAGA 1 cut(s) 98
XspI CTAG 3 cut(s) 99, 125, 177
Zsp2I ATGCAT 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.