Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005982.1

Orthogroup ID

OG0007539

Physical Location & Seq

Genomic Coordinates Reverse (-)

60181 .. 60456

Gene Structure 276 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005982.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 276 bp

atgttatttatctacaggttccttggattgctggcacatggagaaggttggcataacaatcaccatgcttttcagcactctgctcgacacggcttggaatggtggcaaattgatgttacttggtatgtcataagatttcttgaacttgtggctttggcaacagaagtgaagcttccaactgagactcagaagaaacaaagagccttaagaaacatgatgatccacgaggaaaagcagcagcagcttgaagcaaaagtccaaaatggcaacctttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FA_desaturase

Protein Analysis

91

Amino Acids

10.87

Weight (kDa)

8.18

Isoelectric Point (pI)

26.71

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007539)

Species	Orthologous Gene IDs
pyrus_communis	pycom11g16180
rosa_chinensis	RchiOBHm_Chr2g0158081 RchiOBHm_Chr2g0159461 RchiOBHm_Chr4g0425021
rosa_laevigata	RLG00000015820
rosa_multiflora	Rmu_co8373497.1_g000001 Rmu_sc0005982.1_g000015 Rmu_sc0033090.1_g000001 Rmu_ssc0000187.1_g000001
rosa_roxburghii	Rroxscaffold_1G00056800 Rroxscaffold_2G00091620 Rroxscaffold_4G00310500 Rroxscaffold_4G00310510
rosa_rugosa	Rorug07G0052900
rosa_samantha	Rh1AG184500 Rh2BG024500 Rh2BG555100 Rh2DG024600 Rh5AG004400 Rh5BG005900 Rh5CG004800 Rh5DG004800 Rh7BG180000 Rh7BG295000
rosa_wichuraiana	Rw2G043980

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	214
AflII	CTTAAG	1 cut(s)	205
AgsI	TTSAA	2 cut(s)	143, 248
AluBI	AGCT	2 cut(s)	172, 244
AluI	AGCT	2 cut(s)	172, 244
Alw26I	GTCTC	1 cut(s)	176
AlwI	GGATC	1 cut(s)	214
ApeKI	GCWGC	3 cut(s)	235, 238, 241
AsuHPI	GGTGA	1 cut(s)	53
BauI	CACGAG	1 cut(s)	224
BbvI	GCAGC	3 cut(s)	247, 250, 253
BceAI	ACGGC	1 cut(s)	106
BcgI	CGANNNNNNTGC	2 cut(s)	65, 99
BcoDI	GTCTC	1 cut(s)	176
BfmI	CTRYAG	1 cut(s)	13
BfrI	CTTAAG	1 cut(s)	205
BisI	GCNGC	3 cut(s)	236, 239, 242
BlsI	GCNGC	3 cut(s)	237, 240, 243
BmiI	GGNNCC	1 cut(s)	20
BsaJI	CCNNGG	1 cut(s)	22
BseDI	CCNNGG	1 cut(s)	22
BseMII	CTCAG	2 cut(s)	171, 200
BseXI	GCAGC	3 cut(s)	247, 250, 253
BsmAI	GTCTC	1 cut(s)	176
Bsp143I	GATC	1 cut(s)	219
BspCNI	CTCAG	2 cut(s)	172, 199
BspLI	GGNNCC	1 cut(s)	20
BspPI	GGATC	1 cut(s)	214
BspTI	CTTAAG	1 cut(s)	205
BssECI	CCNNGG	1 cut(s)	22
BssMI	GATC	1 cut(s)	219
BssSI	CACGAG	1 cut(s)	224
BssT1I	CCWWGG	1 cut(s)	22
Bst2BI	CACGAG	1 cut(s)	224
BstAFI	CTTAAG	1 cut(s)	205
BstC8I	GCNNGC	1 cut(s)	33
BstDEI	CTNAG	2 cut(s)	180, 186
BstKTI	GATC	1 cut(s)	222
BstMAI	GTCTC	1 cut(s)	176
BstMBI	GATC	1 cut(s)	219
BstMWI	GCNNNNNNNGC	1 cut(s)	241
BstSFI	CTRYAG	1 cut(s)	13
BstV1I	GCAGC	3 cut(s)	247, 250, 253
Cac8I	GCNNGC	1 cut(s)	33
CviAII	CATG	3 cut(s)	38, 65, 214
CviJI	RGCY	5 cut(s)	93, 152, 172, 203, 244
CviKI_1	RGCY	5 cut(s)	93, 152, 172, 203, 244
DdeI	CTNAG	2 cut(s)	180, 186
DpnI	GATC	1 cut(s)	221
DpnII	GATC	1 cut(s)	219
Eco130I	CCWWGG	1 cut(s)	22
EcoT14I	CCWWGG	1 cut(s)	22
ErhI	CCWWGG	1 cut(s)	22
FaeI	CATG	3 cut(s)	41, 68, 217
FaiI	YATR	6 cut(s)	39, 54, 66, 126, 131, 215
FalI	AAGNNNNNCTT	2 cut(s)	156, 188
FatI	CATG	3 cut(s)	37, 64, 213
Fnu4HI	GCNGC	3 cut(s)	236, 239, 242
Fsp4HI	GCNGC	3 cut(s)	236, 239, 242
GluI	GCNGC	3 cut(s)	236, 239, 242
Hin1II	CATG	3 cut(s)	41, 68, 217
HindIII	AAGCTT	1 cut(s)	170
HinfI	GANTC	1 cut(s)	184
HphI	GGTGA	1 cut(s)	53
Hpy188I	TCNGA	1 cut(s)	189
Hpy188III	TCNNGA	1 cut(s)	140
HpyAV	CCTTC	1 cut(s)	38
HpyF10VI	GCNNNNNNNGC	1 cut(s)	241
HpyF3I	CTNAG	2 cut(s)	180, 186
Hsp92II	CATG	3 cut(s)	41, 68, 217
Kzo9I	GATC	1 cut(s)	219
LpnPI	CCDG	1 cut(s)	17
Lsp1109I	GCAGC	3 cut(s)	247, 250, 253
MaeIII	GTNAC	1 cut(s)	115
MalI	GATC	1 cut(s)	221
MboI	GATC	1 cut(s)	219
MboII	GAAGA	1 cut(s)	202
MluCI	AATT	1 cut(s)	108
MlyI	GAGTC	1 cut(s)	178
MmeI	TCCRAC	1 cut(s)	200
MnlI	CCTC	1 cut(s)	220
MseI	TTAA	1 cut(s)	206
MspCI	CTTAAG	1 cut(s)	205
MwoI	GCNNNNNNNGC	1 cut(s)	241
NdeII	GATC	1 cut(s)	219
NlaIII	CATG	3 cut(s)	41, 68, 217
NlaIV	GGNNCC	1 cut(s)	20
PkrI	GCNGC	3 cut(s)	237, 240, 243
PleI	GAGTC	1 cut(s)	178
PpsI	GAGTC	1 cut(s)	178
PspN4I	GGNNCC	1 cut(s)	20
SaqAI	TTAA	1 cut(s)	206
SatI	GCNGC	3 cut(s)	236, 239, 242
Sau3AI	GATC	1 cut(s)	219
SchI	GAGTC	1 cut(s)	178
SetI	ASST	5 cut(s)	20, 49, 174, 246, 273
SfcI	CTRYAG	1 cut(s)	13
SmlI	CTYRAG	1 cut(s)	205
SmoI	CTYRAG	1 cut(s)	205
Sse9I	AATT	1 cut(s)	108
StyI	CCWWGG	1 cut(s)	22
TaqI	TCGA	1 cut(s)	85
TasI	AATT	1 cut(s)	108
Tru1I	TTAA	1 cut(s)	206
Tru9I	TTAA	1 cut(s)	206
TseI	GCWGC	3 cut(s)	235, 238, 241
Vha464I	CTTAAG	1 cut(s)	205

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.