Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8388519.1

Orthogroup ID

OG0002733

Physical Location & Seq

Genomic Coordinates Reverse (-)

199 .. 1134

Gene Structure 936 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8388519.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 936 bp

atggagactaggaacttcagtaccaaaaatggcaagcgtttgtgtctgcaagaccaagttgctgttgctcttaggaggcttagctctggtgaatcattaatgaacattggtgactcctttgggatgaaccaaacaactgttgctcaggtaacctggcggtttgcggaagcaatagaagagaaggggctccaccatctttgttggcctaaagagcaaggtgaaatggaagagataaagtccaagtttgaaagaattcgtggccttccaaattgctgtggtgcaatcgacatcactcacatcatgatgactctgcctgcagctgactcatcagatgtctggctcgatggtgagaaaaactgcagcatgaccttgcaggcagttgttgaccctgatatgagatttcgtaacatagttactggatggccaggaagtctgagtgatgacattatcctccgaagctcaggtttcttcaaactgtgtgaagaaggaacttgtttaaatggtaagaaaatggtgctgtctgaaggaacagaagtaagagaatacatagtaggagattccggttttccacttttggaatggcttatgactccttaccagggaagaaaactcccagatgataagtctgagtttaacgagcgactttctgcaacccaaatggtggcaaggagagcatttgtgaggttgaaggagatgtggaaattaattcaaggagcaatgtggttgcctgataagaataagctgccgaggattattctcgcttgctgcatactgcataacatagtcattgatatggatgataaggtgcaggacgaaatgcctttgtcccatcaccatgattcgggttaccaccgccagagttgtgaatctgctgacaagactggctctgttctaagagagaaactttctgtatacttctctggacaattaccttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DDE_Tnp_4

Protein Analysis

311

Amino Acids

35.27

Weight (kDa)

5.95

Isoelectric Point (pI)

44.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002733)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G55350
fragaria_vesca	FvH4_3g35001 FvH4_3g35001 FvH4_3g35001 FvH4_3g35001 FvH4_7g21532 FvH4_7g21532
malus_domestica	MD01G1122200.v1.1 MD03G1099600.v1.1 MD07G1191700.v1.1 MD11G1113800.v1.1
prunus_persica	Prupe.2G229800_v2.0.a1 Prupe.6G084600_v2.0.a1
pyrus_communis	pycom01g14910 pycom03g08200 pycom07g18110 pycom11g09580
rosa_chinensis	RchiOBHm_Chr1g0365861 RchiOBHm_Chr5g0062911
rosa_laevigata	RLG00000027385 RLG00000035589
rosa_multiflora	Rmu_co8388519.1_g000001 Rmu_sc0006406.1_g000002 Rmu_sc0010322.1_g000001
rosa_roxburghii	Rroxscaffold_1G00017720 Rroxscaffold_4G00290790 Rroxscaffold_5G00340940
rosa_rugosa	Rorug05G0352700
rosa_samantha	Rh1AG334100 Rh1BG294700 Rh1CG311400 Rh1DG327100 Rh5AG413700 Rh5BG427900 Rh5CG451500 Rh5DG441600
rosa_wichuraiana	Rw1G029640 Rw2G024510 Rw5G038870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	661
AccI	GTMKAC	1 cut(s)	912
AciI	CCGC	3 cut(s)	157, 164, 853
AcoI	YGGCCR	1 cut(s)	422
AcsI	RAATTY	1 cut(s)	252
AcuI	CTGAAG	1 cut(s)	543
AfaI	GTAC	1 cut(s)	22
AfiI	CCNNNNNNNGG	3 cut(s)	599, 661, 841
AgsI	TTSAA	4 cut(s)	248, 472, 688, 710
AjnI	CCWGG	3 cut(s)	152, 424, 597
AluBI	AGCT	4 cut(s)	84, 320, 459, 742
AluI	AGCT	4 cut(s)	84, 320, 459, 742
AoxI	GGCC	3 cut(s)	203, 259, 422
ApeKI	GCWGC	4 cut(s)	317, 360, 742, 765
ApoI	RAATTY	1 cut(s)	252
AseI	ATTAAT	2 cut(s)	98, 704
Asp700I	GAANNNNTTC	1 cut(s)	252
AsuHPI	GGTGA	5 cut(s)	101, 122, 230, 359, 824
BaeI	ACNNNNGTAYC	1 cut(s)	37
BalI	TGGCCA	1 cut(s)	424
BanII	GRGCYC	1 cut(s)	189
BbvI	GCAGC	4 cut(s)	329, 372, 729, 752
BccI	CCATC	4 cut(s)	201, 338, 414, 837
BciT130I	CCWGG	3 cut(s)	154, 426, 599
BfaI	CTAG	1 cut(s)	9
BfmI	CTRYAG	2 cut(s)	315, 358
BisI	GCNGC	4 cut(s)	318, 361, 743, 766
BlpI	GCTNAGC	1 cut(s)	80
BlsI	GCNGC	4 cut(s)	319, 362, 744, 767
Bme1390I	CCNGG	3 cut(s)	154, 426, 599
BmiI	GGNNCC	1 cut(s)	188
BmrFI	CCNGG	3 cut(s)	154, 426, 599
Bpu10I	CCTNAGC	2 cut(s)	144, 460
Bpu1102I	GCTNAGC	1 cut(s)	80
BsaJI	CCNNGG	2 cut(s)	598, 746
BsaWI	WCCGGW	1 cut(s)	560
Bsc4I	CCNNNNNNNGG	3 cut(s)	599, 661, 841
Bse1I	ACTGG	2 cut(s)	421, 886
Bse3DI	GCAATG	1 cut(s)	723
BseBI	CCWGG	3 cut(s)	154, 426, 599
BseDI	CCNNGG	2 cut(s)	598, 746
BseGI	GGATG	3 cut(s)	129, 425, 802
BseLI	CCNNNNNNNGG	3 cut(s)	599, 661, 841
BseMI	GCAATG	1 cut(s)	723
BseMII	CTCAG	4 cut(s)	158, 425, 474, 618
BseNI	ACTGG	2 cut(s)	421, 886
BseXI	GCAGC	4 cut(s)	329, 372, 729, 752
BsgI	GTGCAG	1 cut(s)	827
BshFI	GGCC	3 cut(s)	205, 261, 424
BsiSI	CCGG	1 cut(s)	561
BslFI	GGGAC	1 cut(s)	811
BslI	CCNNNNNNNGG	3 cut(s)	599, 661, 841
BsmFI	GGGAC	1 cut(s)	811
BsnI	GGCC	3 cut(s)	205, 261, 424
Bsp1286I	GDGCHC	1 cut(s)	189
Bsp1720I	GCTNAGC	1 cut(s)	80
BspACI	CCGC	3 cut(s)	157, 164, 853
BspANI	GGCC	3 cut(s)	205, 261, 424
BspCNI	CTCAG	4 cut(s)	157, 426, 473, 619
BspHI	TCATGA	1 cut(s)	300
BspLI	GGNNCC	1 cut(s)	188
BspMAI	CTGCAG	2 cut(s)	319, 362
BsrDI	GCAATG	1 cut(s)	723
BsrI	ACTGG	2 cut(s)	421, 886
BssECI	CCNNGG	2 cut(s)	598, 746
BssNAI	GTATAC	1 cut(s)	913
Bst1107I	GTATAC	1 cut(s)	913
Bst2UI	CCWGG	3 cut(s)	154, 426, 599
Bst4CI	ACNGT	2 cut(s)	139, 477
Bst6I	CTCTTC	2 cut(s)	171, 222
BstC8I	GCNNGC	4 cut(s)	35, 315, 375, 763
BstDEI	CTNAG	7 cut(s)	71, 80, 144, 434, 460, 627, 893
BstEII	GGTNACC	2 cut(s)	148, 845
BstF5I	GGATG	3 cut(s)	129, 425, 802
BstMWI	GCNNNNNNNGC	2 cut(s)	211, 671
BstNI	CCWGG	3 cut(s)	154, 426, 599
BstPI	GGTNACC	2 cut(s)	148, 845
BstSCI	CCNGG	3 cut(s)	152, 424, 597
BstSFI	CTRYAG	2 cut(s)	315, 358
BstV1I	GCAGC	4 cut(s)	329, 372, 729, 752
BstZ17I	GTATAC	1 cut(s)	913
BsuRI	GGCC	3 cut(s)	205, 261, 424
BtsCI	GGATG	3 cut(s)	129, 425, 802
Cac8I	GCNNGC	4 cut(s)	35, 315, 375, 763
CciI	TCATGA	1 cut(s)	300
Csp6I	GTAC	1 cut(s)	21
CspCI	CAANNNNNGTGG	2 cut(s)	179, 214
CviAII	CATG	3 cut(s)	301, 364, 836
CviQI	GTAC	1 cut(s)	21
DdeI	CTNAG	7 cut(s)	71, 80, 144, 434, 460, 627, 893
DraI	TTTAAA	1 cut(s)	498
EaeI	YGGCCR	1 cut(s)	422
Eam1104I	CTCTTC	2 cut(s)	171, 222
EarI	CTCTTC	2 cut(s)	171, 222
Eco24I	GRGCYC	1 cut(s)	189
Eco57I	CTGAAG	1 cut(s)	543
Eco91I	GGTNACC	2 cut(s)	148, 845
EcoO65I	GGTNACC	2 cut(s)	148, 845
EcoRI	GAATTC	1 cut(s)	252
EcoRII	CCWGG	3 cut(s)	152, 424, 597
EcoT38I	GRGCYC	1 cut(s)	189
FaeI	CATG	3 cut(s)	304, 367, 839
FaqI	GGGAC	1 cut(s)	811
FatI	CATG	3 cut(s)	300, 363, 835
FblI	GTMKAC	1 cut(s)	912
Fnu4HI	GCNGC	4 cut(s)	318, 361, 743, 766
FokI	GGATG	3 cut(s)	136, 432, 809
FriOI	GRGCYC	1 cut(s)	189
Fsp4HI	GCNGC	4 cut(s)	318, 361, 743, 766
FspBI	CTAG	1 cut(s)	9
GluI	GCNGC	4 cut(s)	318, 361, 743, 766
HaeIII	GGCC	3 cut(s)	205, 261, 424
HapII	CCGG	1 cut(s)	561
Hin1II	CATG	3 cut(s)	304, 367, 839
HincII	GTYRAC	1 cut(s)	385
HindII	GTYRAC	1 cut(s)	385
HinfI	GANTC	8 cut(s)	92, 113, 307, 323, 557, 589, 839, 866
HpaII	CCGG	1 cut(s)	561
HphI	GGTGA	5 cut(s)	101, 122, 230, 359, 824
Hpy166II	GTNNAC	2 cut(s)	385, 913
Hpy188I	TCNGA	5 cut(s)	331, 435, 455, 523, 628
Hpy188III	TCNNGA	2 cut(s)	301, 921
Hpy8I	GTNNAC	2 cut(s)	385, 913
HpyAV	CCTTC	5 cut(s)	175, 272, 479, 518, 682
HpyCH4III	ACNGT	2 cut(s)	139, 477
HpyCH4V	TGCA	9 cut(s)	49, 281, 317, 360, 373, 650, 768, 775, 808
HpyF10VI	GCNNNNNNNGC	2 cut(s)	211, 671
HpyF3I	CTNAG	7 cut(s)	71, 80, 144, 434, 460, 627, 893
Hsp92II	CATG	3 cut(s)	304, 367, 839
LmnI	GCTCC	2 cut(s)	192, 713
Lsp1109I	GCAGC	4 cut(s)	329, 372, 729, 752
MaeI	CTAG	1 cut(s)	9
MaeIII	GTNAC	5 cut(s)	110, 148, 404, 412, 845
MboII	GAAGA	5 cut(s)	188, 239, 460, 494, 615
MhlI	GDGCHC	1 cut(s)	189
MlsI	TGGCCA	1 cut(s)	424
MluCI	AATT	5 cut(s)	252, 268, 701, 705, 926
MluNI	TGGCCA	1 cut(s)	424
MlyI	GAGTC	4 cut(s)	107, 301, 317, 583
MnlI	CCTC	4 cut(s)	69, 461, 675, 741
Mox20I	TGGCCA	1 cut(s)	424
MroXI	GAANNNNTTC	1 cut(s)	252
MscI	TGGCCA	1 cut(s)	424
MseI	TTAA	4 cut(s)	98, 497, 633, 704
MslI	CAYNNNNRTG	3 cut(s)	302, 791, 834
Msp20I	TGGCCA	1 cut(s)	424
MspA1I	CMGCKG	1 cut(s)	320
MspI	CCGG	1 cut(s)	561
MspR9I	CCNGG	3 cut(s)	154, 426, 599
MvaI	CCWGG	3 cut(s)	154, 426, 599
MwoI	GCNNNNNNNGC	2 cut(s)	211, 671
NlaIII	CATG	3 cut(s)	304, 367, 839
NlaIV	GGNNCC	1 cut(s)	188
NmeAIII	GCCGAG	1 cut(s)	771
NmuCI	GTSAC	1 cut(s)	110
PagI	TCATGA	1 cut(s)	300
PdmI	GAANNNNTTC	1 cut(s)	252
PfeI	GAWTC	4 cut(s)	92, 557, 839, 866
PflMI	CCANNNNNTGG	1 cut(s)	661
PkrI	GCNGC	4 cut(s)	319, 362, 744, 767
PleI	GAGTC	4 cut(s)	107, 301, 317, 583
PpsI	GAGTC	4 cut(s)	107, 301, 317, 583
PshBI	ATTAAT	2 cut(s)	98, 704
Psp6I	CCWGG	3 cut(s)	152, 424, 597
PspEI	GGTNACC	2 cut(s)	148, 845
PspGI	CCWGG	3 cut(s)	152, 424, 597
PspN4I	GGNNCC	1 cut(s)	188
PstI	CTGCAG	2 cut(s)	319, 362
PvuII	CAGCTG	1 cut(s)	320
RsaI	GTAC	1 cut(s)	22
RsaNI	GTAC	1 cut(s)	21
RseI	CAYNNNNRTG	3 cut(s)	302, 791, 834
SaqAI	TTAA	4 cut(s)	98, 497, 633, 704
SatI	GCNGC	4 cut(s)	318, 361, 743, 766
SchI	GAGTC	4 cut(s)	107, 301, 317, 583
ScrFI	CCNGG	3 cut(s)	154, 426, 599
SduI	GDGCHC	1 cut(s)	189
SfcI	CTRYAG	2 cut(s)	315, 358
SmiMI	CAYNNNNRTG	3 cut(s)	302, 791, 834
Sse9I	AATT	5 cut(s)	252, 268, 701, 705, 926
SsiI	CCGC	3 cut(s)	157, 164, 853
SspMI	CTAG	1 cut(s)	9
StyD4I	CCNGG	3 cut(s)	152, 424, 597
TaaI	ACNGT	2 cut(s)	139, 477
TaqI	TCGA	2 cut(s)	285, 342
TasI	AATT	5 cut(s)	252, 268, 701, 705, 926
TfiI	GAWTC	4 cut(s)	92, 557, 839, 866
Tru1I	TTAA	4 cut(s)	98, 497, 633, 704
Tru9I	TTAA	4 cut(s)	98, 497, 633, 704
TseFI	GTSAC	1 cut(s)	110
TseI	GCWGC	4 cut(s)	317, 360, 742, 765
Tsp45I	GTSAC	1 cut(s)	110
TspDTI	ATGAA	2 cut(s)	116, 140
Van91I	CCANNNNNTGG	1 cut(s)	661
VspI	ATTAAT	2 cut(s)	98, 704
XapI	RAATTY	1 cut(s)	252
XcmI	CCANNNNNNNNNTGG	1 cut(s)	576
XmiI	GTMKAC	1 cut(s)	912
XmnI	GAANNNNTTC	1 cut(s)	252
XspI	CTAG	1 cut(s)	9

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.