Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010322.1

Orthogroup ID

OG0002733

Physical Location & Seq

Genomic Coordinates Forward (+)

1971 .. 5625

Gene Structure 3655 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010322.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1191 bp

atgggtcctgtgaggggtcttaagaagagaaagaaggcagagaagaacaagtctcatgaagatcaaaatgcttctggttctgggtcctcagagaaggaaggtcctttggattggtgggatgagttctccaagagaatcaatggtcttcagtctccagcaaagggtttaagtaggtttcaatctatctttaagatgtccagaaaaacctttgactacatatgctcacttgtgagtgaagaaatgatggctaagtcagcacattttgtgtttaataatggtacgccattgtctttatatgatcaagtagctgtggctttaagaagactgagctctggtgagtcactagtaatgatcggtgattcatttgggctgaaccactctgccgtgtctcaagtgacctggcgatttgtggaagccatggaacaaaagggacttcaccacctgcaatggccttcaactgaagcagaaatggcagaaatcaaattgaaatttcagaaaatgcaagggtttcctaattgttgtggtgctgttgatactactcacatcatgatgtgtttaccagcttcagaccccacaagcaatgcatggctcgatcaagagaagaattacagcatggtcttgcaggccattgtggacccggacatgaggttccgggacataatcactggatggccagggaaaatgaaggactggttggtgtttcagagttctaagtttcatgaactctgtgataaaggagagaggttgaatgggaaagttttagagctctccaaaggatttgatataagggaatacataattggggattcaggctttcctttactgccttatcttgtaatcccctatgaagggaaagaactcccagaacaaaaagatgagttcaataagcggcagcgtgccacccaaatggtggcacagagagcattagcaaggttgaaggactcatggaggatcatcgaaggtgtgatgtggagacctgacaaacacagattgccgaggattattctcgtttgctgcttgcttcataacattgtcatcgacatggaagatgaagtgctggatcacctgcctttgtctcacaaccatgatgacccggcttaccaccaacagatttgtggaactcttgacataaatggtgttcatctcagagatgagctgtctctctacttgtctggaaggatgccatcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DDE_Tnp_4

Protein Analysis

396

Amino Acids

45.23

Weight (kDa)

6.71

Isoelectric Point (pI)

44.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002733)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G55350
fragaria_vesca	FvH4_3g35001 FvH4_3g35001 FvH4_3g35001 FvH4_3g35001 FvH4_7g21532 FvH4_7g21532
malus_domestica	MD01G1122200.v1.1 MD03G1099600.v1.1 MD07G1191700.v1.1 MD11G1113800.v1.1
prunus_persica	Prupe.2G229800_v2.0.a1 Prupe.6G084600_v2.0.a1
pyrus_communis	pycom01g14910 pycom03g08200 pycom07g18110 pycom11g09580
rosa_chinensis	RchiOBHm_Chr1g0365861 RchiOBHm_Chr5g0062911
rosa_laevigata	RLG00000027385 RLG00000035589
rosa_multiflora	Rmu_co8388519.1_g000001 Rmu_sc0006406.1_g000002 Rmu_sc0010322.1_g000001
rosa_roxburghii	Rroxscaffold_1G00017720 Rroxscaffold_4G00290790 Rroxscaffold_5G00340940
rosa_rugosa	Rorug05G0352700
rosa_samantha	Rh1AG334100 Rh1BG294700 Rh1CG311400 Rh1DG327100 Rh5AG413700 Rh5BG427900 Rh5CG451500 Rh5DG441600
rosa_wichuraiana	Rw1G029640 Rw2G024510 Rw5G038870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	2 cut(s)	450, 1074
Acc36I	ACCTGC	2 cut(s)	450, 1074
AccB7I	CCANNNNNTGG	1 cut(s)	910
AciI	CCGC	1 cut(s)	889
AclWI	GGATC	2 cut(s)	959, 1068
AcoI	YGGCCR	1 cut(s)	671
AcsI	RAATTY	1 cut(s)	488
AcuI	CTGAAG	3 cut(s)	131, 480, 549
AfaI	GTAC	1 cut(s)	280
AfiI	CCNNNNNNNGG	5 cut(s)	14, 161, 848, 849, 910
AflII	CTTAAG	1 cut(s)	20
AgsI	TTSAA	6 cut(s)	179, 456, 487, 748, 883, 937
AhlI	ACTAGT	1 cut(s)	343
AjnI	CCWGG	2 cut(s)	398, 673
AjuI	GAANNNNNNNTTGG	4 cut(s)	677, 709, 783, 815
AloI	GAACNNNNNNTCC	2 cut(s)	632, 664
AluBI	AGCT	5 cut(s)	308, 330, 563, 766, 1156
AluI	AGCT	5 cut(s)	308, 330, 563, 766, 1156
Alw21I	GWGCWC	2 cut(s)	332, 768
Alw26I	GTCTC	6 cut(s)	57, 156, 393, 967, 1080, 1164
AlwI	GGATC	2 cut(s)	959, 1068
AoxI	GGCC	3 cut(s)	449, 624, 671
ApeKI	GCWGC	2 cut(s)	892, 1014
ApoI	RAATTY	1 cut(s)	488
AspS9I	GGNCC	4 cut(s)	5, 84, 101, 634
AsuC2I	CCSGG	3 cut(s)	638, 653, 1094
AsuHPI	GGTGA	4 cut(s)	347, 368, 428, 1055
AvaII	GGWCC	4 cut(s)	5, 84, 101, 634
BalI	TGGCCA	1 cut(s)	673
BanII	GRGCYC	2 cut(s)	332, 768
BbsI	GAAGAC	2 cut(s)	137, 328
Bbv12I	GWGCWC	2 cut(s)	332, 768
BbvI	GCAGC	2 cut(s)	904, 1001
BccI	CCATC	2 cut(s)	238, 663
BceAI	ACGGC	1 cut(s)	368
BciT130I	CCWGG	2 cut(s)	400, 675
BclI	TGATCA	1 cut(s)	298
BcnI	CCSGG	3 cut(s)	638, 653, 1094
BcoDI	GTCTC	6 cut(s)	57, 156, 393, 967, 1080, 1164
BcuI	ACTAGT	1 cut(s)	343
BfaI	CTAG	1 cut(s)	344
BfrI	CTTAAG	1 cut(s)	20
BfuAI	ACCTGC	2 cut(s)	450, 1074
BisI	GCNGC	3 cut(s)	890, 893, 1015
BlsI	GCNGC	3 cut(s)	891, 894, 1016
Bme1390I	CCNGG	5 cut(s)	400, 638, 653, 675, 1094
Bme18I	GGWCC	4 cut(s)	5, 84, 101, 634
BmgT120I	GGNCC	4 cut(s)	5, 84, 101, 634
BmiI	GGNNCC	4 cut(s)	6, 85, 636, 650
BmrFI	CCNGG	5 cut(s)	400, 638, 653, 675, 1094
BmsI	GCATC	1 cut(s)	1170
BpiI	GAAGAC	2 cut(s)	137, 328
BpmI	CTGGAG	1 cut(s)	138
BpuEI	CTTGAG	1 cut(s)	375
BpuMI	CCSGG	3 cut(s)	638, 653, 1094
BsaI	GGTCTC	1 cut(s)	967
BsaJI	CCNNGG	3 cut(s)	417, 674, 995
Bsc4I	CCNNNNNNNGG	5 cut(s)	14, 161, 848, 849, 910
Bse1I	ACTGG	2 cut(s)	670, 695
Bse3DI	GCAATG	2 cut(s)	452, 586
BseBI	CCWGG	2 cut(s)	400, 675
BseDI	CCNNGG	3 cut(s)	417, 674, 995
BseGI	GGATG	3 cut(s)	124, 674, 1185
BseLI	CCNNNNNNNGG	5 cut(s)	14, 161, 848, 849, 910
BseMI	GCAATG	2 cut(s)	452, 586
BseMII	CTCAG	3 cut(s)	102, 317, 1159
BseNI	ACTGG	2 cut(s)	670, 695
BseXI	GCAGC	2 cut(s)	904, 1001
BshFI	GGCC	3 cut(s)	451, 626, 673
BsiHKAI	GWGCWC	2 cut(s)	332, 768
BsiSI	CCGG	3 cut(s)	638, 652, 1094
BslFI	GGGAC	2 cut(s)	444, 668
BslI	CCNNNNNNNGG	5 cut(s)	14, 161, 848, 849, 910
BsmAI	GTCTC	6 cut(s)	57, 156, 393, 967, 1080, 1164
BsmFI	GGGAC	2 cut(s)	444, 668
BsnI	GGCC	3 cut(s)	451, 626, 673
Bso31I	GGTCTC	1 cut(s)	967
Bsp1286I	GDGCHC	2 cut(s)	332, 768
Bsp143I	GATC	6 cut(s)	61, 298, 351, 592, 951, 1060
Bsp19I	CCATGG	1 cut(s)	417
BspACI	CCGC	1 cut(s)	889
BspANI	GGCC	3 cut(s)	451, 626, 673
BspCNI	CTCAG	3 cut(s)	101, 318, 1158
BspHI	TCATGA	3 cut(s)	55, 546, 718
BspLI	GGNNCC	4 cut(s)	6, 85, 636, 650
BspMI	ACCTGC	2 cut(s)	450, 1074
BspPI	GGATC	2 cut(s)	959, 1068
BspTI	CTTAAG	1 cut(s)	20
BspTNI	GGTCTC	1 cut(s)	967
BsrDI	GCAATG	2 cut(s)	452, 586
BsrI	ACTGG	2 cut(s)	670, 695
BssECI	CCNNGG	3 cut(s)	417, 674, 995
BssMI	GATC	6 cut(s)	61, 298, 351, 592, 951, 1060
BssT1I	CCWWGG	1 cut(s)	417
Bst2UI	CCWGG	2 cut(s)	400, 675
Bst6I	CTCTTC	1 cut(s)	20
BstAFI	CTTAAG	1 cut(s)	20
BstC8I	GCNNGC	3 cut(s)	624, 897, 1019
BstDEI	CTNAG	5 cut(s)	88, 249, 326, 711, 1145
BstDSI	CCRYGG	1 cut(s)	417
BstF5I	GGATG	3 cut(s)	124, 674, 1185
BstKTI	GATC	6 cut(s)	64, 301, 354, 595, 954, 1063
BstMAI	GTCTC	6 cut(s)	57, 156, 393, 967, 1080, 1164
BstMBI	GATC	6 cut(s)	61, 298, 351, 592, 951, 1060
BstMWI	GCNNNNNNNGC	3 cut(s)	254, 470, 920
BstNI	CCWGG	2 cut(s)	400, 675
BstSCI	CCNGG	5 cut(s)	398, 636, 651, 673, 1092
BstV1I	GCAGC	2 cut(s)	904, 1001
BstV2I	GAAGAC	2 cut(s)	137, 328
BstXI	CCANNNNNNTGG	1 cut(s)	907
BsuRI	GGCC	3 cut(s)	451, 626, 673
BtgI	CCRYGG	1 cut(s)	417
BtsCI	GGATG	3 cut(s)	124, 674, 1185
BtsIMutI	CAGTG	1 cut(s)	663
BveI	ACCTGC	2 cut(s)	450, 1074
Cac8I	GCNNGC	3 cut(s)	624, 897, 1019
CciI	TCATGA	3 cut(s)	55, 546, 718
Cfr13I	GGNCC	4 cut(s)	5, 84, 101, 634
Csp6I	GTAC	1 cut(s)	279
CviQI	GTAC	1 cut(s)	279
DdeI	CTNAG	5 cut(s)	88, 249, 326, 711, 1145
DpnI	GATC	6 cut(s)	63, 300, 353, 594, 953, 1062
DpnII	GATC	6 cut(s)	61, 298, 351, 592, 951, 1060
EaeI	YGGCCR	1 cut(s)	671
Eam1104I	CTCTTC	1 cut(s)	20
EarI	CTCTTC	1 cut(s)	20
Ecl136II	GAGCTC	2 cut(s)	330, 766
Eco130I	CCWWGG	1 cut(s)	417
Eco24I	GRGCYC	2 cut(s)	332, 768
Eco31I	GGTCTC	1 cut(s)	967
Eco47I	GGWCC	4 cut(s)	5, 84, 101, 634
Eco53kI	GAGCTC	2 cut(s)	330, 766
Eco57I	CTGAAG	3 cut(s)	131, 480, 549
EcoICRI	GAGCTC	2 cut(s)	330, 766
EcoO109I	RGGNCCY	3 cut(s)	5, 84, 101
EcoRII	CCWGG	2 cut(s)	398, 673
EcoT14I	CCWWGG	1 cut(s)	417
EcoT22I	ATGCAT	1 cut(s)	586
EcoT38I	GRGCYC	2 cut(s)	332, 768
ErhI	CCWWGG	1 cut(s)	417
FaqI	GGGAC	2 cut(s)	444, 668
FauNDI	CATATG	1 cut(s)	218
FbaI	TGATCA	1 cut(s)	298
Fnu4HI	GCNGC	3 cut(s)	890, 893, 1015
FokI	GGATG	2 cut(s)	131, 681
FriOI	GRGCYC	2 cut(s)	332, 768
Fsp4HI	GCNGC	3 cut(s)	890, 893, 1015
FspBI	CTAG	1 cut(s)	344
GluI	GCNGC	3 cut(s)	890, 893, 1015
GsuI	CTGGAG	1 cut(s)	138
HaeIII	GGCC	3 cut(s)	451, 626, 673
HapII	CCGG	3 cut(s)	638, 652, 1094
HinfI	GANTC	5 cut(s)	135, 338, 359, 806, 941
HpaII	CCGG	3 cut(s)	638, 652, 1094
HphI	GGTGA	4 cut(s)	347, 368, 428, 1055
Hpy166II	GTNNAC	2 cut(s)	557, 634
Hpy188I	TCNGA	5 cut(s)	91, 495, 568, 705, 1148
Hpy188III	TCNNGA	7 cut(s)	56, 198, 547, 596, 719, 1124, 1173
Hpy8I	GTNNAC	2 cut(s)	557, 634
HpyAV	CCTTC	9 cut(s)	28, 88, 92, 462, 679, 842, 931, 953, 1170
HpyCH4V	TGCA	4 cut(s)	445, 502, 584, 622
HpyF10VI	GCNNNNNNNGC	3 cut(s)	254, 470, 920
HpyF3I	CTNAG	5 cut(s)	88, 249, 326, 711, 1145
Ksp22I	TGATCA	1 cut(s)	298
Kzo9I	GATC	6 cut(s)	61, 298, 351, 592, 951, 1060
Lsp1109I	GCAGC	2 cut(s)	904, 1001
LweI	GCATC	1 cut(s)	1170
MaeI	CTAG	1 cut(s)	344
MaeIII	GTNAC	2 cut(s)	339, 394
MalI	GATC	6 cut(s)	63, 300, 353, 594, 953, 1062
MboI	GATC	6 cut(s)	61, 298, 351, 592, 951, 1060
MboII	GAAGA	8 cut(s)	37, 55, 71, 137, 248, 333, 613, 1058
MhlI	GDGCHC	2 cut(s)	332, 768
MlsI	TGGCCA	1 cut(s)	673
MluCI	AATT	5 cut(s)	482, 488, 514, 604, 798
MluNI	TGGCCA	1 cut(s)	673
MlyI	GAGTC	2 cut(s)	347, 935
MnlI	CCTC	6 cut(s)	6, 97, 639, 735, 942, 990
Mox20I	TGGCCA	1 cut(s)	673
Mph1103I	ATGCAT	1 cut(s)	586
MscI	TGGCCA	1 cut(s)	673
MseI	TTAA	6 cut(s)	21, 167, 189, 270, 317, 1189
MslI	CAYNNNNRTG	4 cut(s)	548, 905, 1040, 1083
Msp20I	TGGCCA	1 cut(s)	673
MspCI	CTTAAG	1 cut(s)	20
MspI	CCGG	3 cut(s)	638, 652, 1094
MspR9I	CCNGG	5 cut(s)	400, 638, 653, 675, 1094
MvaI	CCWGG	2 cut(s)	400, 675
MwoI	GCNNNNNNNGC	3 cut(s)	254, 470, 920
NciI	CCSGG	3 cut(s)	638, 653, 1094
NcoI	CCATGG	1 cut(s)	417
NdeI	CATATG	1 cut(s)	218
NdeII	GATC	6 cut(s)	61, 298, 351, 592, 951, 1060
NlaIV	GGNNCC	4 cut(s)	6, 85, 636, 650
NmeAIII	GCCGAG	1 cut(s)	1020
NmuCI	GTSAC	2 cut(s)	339, 394
NsiI	ATGCAT	1 cut(s)	586
PagI	TCATGA	3 cut(s)	55, 546, 718
PaqCI	CACCTGC	2 cut(s)	450, 1074
PfeI	GAWTC	3 cut(s)	135, 359, 806
PflMI	CCANNNNNTGG	1 cut(s)	910
PfoI	TCCNGGA	1 cut(s)	651
PkrI	GCNGC	3 cut(s)	891, 894, 1016
PleI	GAGTC	2 cut(s)	346, 935
PpsI	GAGTC	2 cut(s)	346, 935
PpuMI	RGGWCCY	3 cut(s)	5, 84, 101
Psp124BI	GAGCTC	2 cut(s)	332, 768
Psp5II	RGGWCCY	3 cut(s)	5, 84, 101
Psp6I	CCWGG	2 cut(s)	398, 673
PspGI	CCWGG	2 cut(s)	398, 673
PspN4I	GGNNCC	4 cut(s)	6, 85, 636, 650
PspPI	GGNCC	4 cut(s)	5, 84, 101, 634
PspPPI	RGGWCCY	3 cut(s)	5, 84, 101
RsaI	GTAC	1 cut(s)	280
RsaNI	GTAC	1 cut(s)	279
RseI	CAYNNNNRTG	4 cut(s)	548, 905, 1040, 1083
SacI	GAGCTC	2 cut(s)	332, 768
SaqAI	TTAA	6 cut(s)	21, 167, 189, 270, 317, 1189
SatI	GCNGC	3 cut(s)	890, 893, 1015
Sau3AI	GATC	6 cut(s)	61, 298, 351, 592, 951, 1060
Sau96I	GGNCC	4 cut(s)	5, 84, 101, 634
SchI	GAGTC	2 cut(s)	347, 935
ScrFI	CCNGG	5 cut(s)	400, 638, 653, 675, 1094
SduI	GDGCHC	2 cut(s)	332, 768
SfaNI	GCATC	1 cut(s)	1170
SinI	GGWCC	4 cut(s)	5, 84, 101, 634
SmiMI	CAYNNNNRTG	4 cut(s)	548, 905, 1040, 1083
SmlI	CTYRAG	2 cut(s)	20, 390
SmoI	CTYRAG	2 cut(s)	20, 390
SpeI	ACTAGT	1 cut(s)	343
Sse9I	AATT	5 cut(s)	482, 488, 514, 604, 798
SsiI	CCGC	1 cut(s)	889
SspMI	CTAG	1 cut(s)	344
SstI	GAGCTC	2 cut(s)	332, 768
StyD4I	CCNGG	5 cut(s)	398, 636, 651, 673, 1092
StyI	CCWWGG	1 cut(s)	417
TaqI	TCGA	3 cut(s)	591, 957, 1038
TasI	AATT	5 cut(s)	482, 488, 514, 604, 798
TauI	GCSGC	1 cut(s)	892
TfiI	GAWTC	3 cut(s)	135, 359, 806
Tru1I	TTAA	6 cut(s)	21, 167, 189, 270, 317, 1189
Tru9I	TTAA	6 cut(s)	21, 167, 189, 270, 317, 1189
TscAI	CASTG	1 cut(s)	670
TseFI	GTSAC	2 cut(s)	339, 394
TseI	GCWGC	2 cut(s)	892, 1014
Tsp45I	GTSAC	2 cut(s)	339, 394
TspDTI	ATGAA	9 cut(s)	72, 351, 698, 707, 735, 861, 1013, 1065, 1130
TspRI	CASTG	1 cut(s)	670
Van91I	CCANNNNNTGG	1 cut(s)	910
Vha464I	CTTAAG	1 cut(s)	20
VpaK11BI	GGWCC	4 cut(s)	5, 84, 101, 634
XapI	RAATTY	1 cut(s)	488
XcmI	CCANNNNNNNNNTGG	2 cut(s)	907, 1112
XspI	CTAG	1 cut(s)	344
Zsp2I	ATGCAT	1 cut(s)	586

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.