Rmu_co8391555.1_g000001

splicing factor 3A subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8391555.1
Physical Location & Seq
Forward (+)
1 .. 355
355 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8391555.1_g000001.1.cds

Sequence Viewer

Length: 355 bp
tccgcatgcagaacctaagccaaagcgacagaagcttgatgattcaatgcttattccagaagataaatttctggcacagcatccgggaccggtcggtatcaatatatctgtttccattgttgacgaaggtaacctcagaggacaacttttggagatcacagtgcagtctttatcagaaactgttggcagtctgaaagagaaaatttctagggaaatccagcttccggcaaacaaacagaaattgagtggaaatacgggctttcttaaagacaatttgtcccttgcatattacaatgtaggggcaggacaaacacttgctctttcaataagagagcgtggtggaagaaagagatga

Protein Analysis

117

Amino Acids

12.82

Weight (kDa)

9.53

Isoelectric Point (pI)

34.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 3
AcsI RAATTY 2 cut(s) 66, 202
AfiI CCNNNNNNNGG 1 cut(s) 224
AgeI ACCGGT 1 cut(s) 89
AgsI TTSAA 2 cut(s) 46, 325
AhdI GACNNNNNGTC 1 cut(s) 275
AluBI AGCT 2 cut(s) 35, 221
AluI AGCT 2 cut(s) 35, 221
AlwNI CAGNNNCTG 1 cut(s) 180
ApoI RAATTY 2 cut(s) 66, 202
AsiGI ACCGGT 1 cut(s) 89
AspS9I GGNCC 1 cut(s) 87
AsuC2I CCSGG 1 cut(s) 85
AvaII GGWCC 1 cut(s) 87
BcnI CCSGG 1 cut(s) 85
BfaI CTAG 1 cut(s) 208
Bme1390I CCNGG 1 cut(s) 85
Bme18I GGWCC 1 cut(s) 87
BmeRI GACNNNNNGTC 1 cut(s) 275
BmgT120I GGNCC 1 cut(s) 87
BmiI GGNNCC 1 cut(s) 88
BmrFI CCNGG 1 cut(s) 85
BmsI GCATC 1 cut(s) 89
Bpu10I CCTNAGC 1 cut(s) 16
BpuMI CCSGG 1 cut(s) 85
BsaWI WCCGGW 1 cut(s) 89
Bsc4I CCNNNNNNNGG 1 cut(s) 224
Bse118I RCCGGY 1 cut(s) 89
BseGI GGATG 1 cut(s) 80
BseLI CCNNNNNNNGG 1 cut(s) 224
BseMII CTCAG 1 cut(s) 149
BsgI GTGCAG 1 cut(s) 183
Bsh1285I CGRYCG 1 cut(s) 94
BshTI ACCGGT 1 cut(s) 89
BsiEI CGRYCG 1 cut(s) 94
BsiSI CCGG 3 cut(s) 84, 90, 225
BslFI GGGAC 2 cut(s) 100, 263
BslI CCNNNNNNNGG 1 cut(s) 224
BsmFI GGGAC 2 cut(s) 100, 263
Bsp143I GATC 1 cut(s) 154
BspACI CCGC 1 cut(s) 3
BspCNI CTCAG 1 cut(s) 148
BspLI GGNNCC 1 cut(s) 88
BsrFI RCCGGY 1 cut(s) 89
BssAI RCCGGY 1 cut(s) 89
BssMI GATC 1 cut(s) 154
Bst4CI ACNGT 2 cut(s) 161, 182
BstC8I GCNNGC 1 cut(s) 7
BstDEI CTNAG 2 cut(s) 16, 135
BstEII GGTNACC 1 cut(s) 129
BstF5I GGATG 1 cut(s) 80
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstMCI CGRYCG 1 cut(s) 94
BstMWI GCNNNNNNNGC 1 cut(s) 32
BstNSI RCATGY 1 cut(s) 9
BstPI GGTNACC 1 cut(s) 129
BstSCI CCNGG 1 cut(s) 83
BtsCI GGATG 1 cut(s) 80
BtsIMutI CAGTG 1 cut(s) 166
Cac8I GCNNGC 1 cut(s) 7
CaiI CAGNNNCTG 1 cut(s) 180
Cfr10I RCCGGY 1 cut(s) 89
Cfr13I GGNCC 1 cut(s) 87
CspAI ACCGGT 1 cut(s) 89
CviAII CATG 1 cut(s) 6
CviJI RGCY 4 cut(s) 20, 35, 221, 259
CviKI_1 RGCY 4 cut(s) 20, 35, 221, 259
DdeI CTNAG 2 cut(s) 16, 135
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
DriI GACNNNNNGTC 1 cut(s) 275
Eam1105I GACNNNNNGTC 1 cut(s) 275
Eco47I GGWCC 1 cut(s) 87
Eco91I GGTNACC 1 cut(s) 129
EcoO65I GGTNACC 1 cut(s) 129
FaeI CATG 1 cut(s) 9
FaiI YATR 3 cut(s) 7, 105, 287
FaqI GGGAC 2 cut(s) 100, 263
FatI CATG 1 cut(s) 5
FokI GGATG 1 cut(s) 67
FspBI CTAG 1 cut(s) 208
HapII CCGG 3 cut(s) 84, 90, 225
Hin1II CATG 1 cut(s) 9
HincII GTYRAC 1 cut(s) 122
HindII GTYRAC 1 cut(s) 122
HindIII AAGCTT 1 cut(s) 33
HinfI GANTC 1 cut(s) 42
HpaII CCGG 3 cut(s) 84, 90, 225
Hpy166II GTNNAC 1 cut(s) 122
Hpy188I TCNGA 3 cut(s) 138, 176, 193
Hpy188III TCNNGA 1 cut(s) 57
Hpy8I GTNNAC 1 cut(s) 122
HpyAV CCTTC 1 cut(s) 120
HpyCH4III ACNGT 2 cut(s) 161, 182
HpyCH4V TGCA 3 cut(s) 9, 164, 285
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
HpyF3I CTNAG 2 cut(s) 16, 135
Hsp92II CATG 1 cut(s) 9
Kzo9I GATC 1 cut(s) 154
LpnPI CCDG 7 cut(s) 57, 70, 97, 103, 231, 238, 289
LweI GCATC 1 cut(s) 89
MaeI CTAG 1 cut(s) 208
MaeIII GTNAC 1 cut(s) 129
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MboII GAAGA 2 cut(s) 72, 355
MluCI AATT 4 cut(s) 66, 202, 240, 272
MnlI CCTC 2 cut(s) 132, 144
MseI TTAA 1 cut(s) 265
MspI CCGG 3 cut(s) 84, 90, 225
MspR9I CCNGG 1 cut(s) 85
MwoI GCNNNNNNNGC 1 cut(s) 32
NciI CCSGG 1 cut(s) 85
NdeII GATC 1 cut(s) 154
NlaIII CATG 1 cut(s) 9
NlaIV GGNNCC 1 cut(s) 88
NspI RCATGY 1 cut(s) 9
PaeI GCATGC 1 cut(s) 9
PfeI GAWTC 1 cut(s) 42
PfoI TCCNGGA 1 cut(s) 83
PinAI ACCGGT 1 cut(s) 89
PspEI GGTNACC 1 cut(s) 129
PspN4I GGNNCC 1 cut(s) 88
PspPI GGNCC 1 cut(s) 87
PstNI CAGNNNCTG 1 cut(s) 180
SaqAI TTAA 1 cut(s) 265
Sau3AI GATC 1 cut(s) 154
Sau96I GGNCC 1 cut(s) 87
ScrFI CCNGG 1 cut(s) 85
SetI ASST 5 cut(s) 17, 37, 131, 136, 223
SfaNI GCATC 1 cut(s) 89
SinI GGWCC 1 cut(s) 87
SphI GCATGC 1 cut(s) 9
Sse9I AATT 4 cut(s) 66, 202, 240, 272
SsiI CCGC 1 cut(s) 3
SspMI CTAG 1 cut(s) 208
StyD4I CCNGG 1 cut(s) 83
TaaI ACNGT 2 cut(s) 161, 182
TasI AATT 4 cut(s) 66, 202, 240, 272
TfiI GAWTC 1 cut(s) 42
Tru1I TTAA 1 cut(s) 265
Tru9I TTAA 1 cut(s) 265
TscAI CASTG 1 cut(s) 166
TspRI CASTG 1 cut(s) 166
VpaK11BI GGWCC 1 cut(s) 87
XapI RAATTY 2 cut(s) 66, 202
XceI RCATGY 1 cut(s) 9
XspI CTAG 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.