Rmu_co8412991.1_g000001

PLAC8 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8412991.1
Physical Location & Seq
Reverse (-)
1 .. 981
981 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8412991.1_g000001.1.cds

Sequence Viewer

Length: 267 bp
atgaagcgagctggttttggtcctggctttttacagggaactcttcatttagttcttgttgcgagcatccttctcaactgcattgcgtttattatcaccaagaagcgctgctttatatatctggtggttgctttcaccattacactaggaacgtatttggggtacttccgtacacagataagaaacaaatttaacataaggggtaatgatagttccatggatgattgcatctaccaccttgtctgcccatgctgcacattatctcag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

10.03

Weight (kDa)

9.24

Isoelectric Point (pI)

38.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 188
AfaI GTAC 2 cut(s) 164, 172
AfeI AGCGCT 1 cut(s) 107
AjnI CCWGG 1 cut(s) 22
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
Aor51HI AGCGCT 1 cut(s) 107
ApeKI GCWGC 2 cut(s) 108, 252
ApoI RAATTY 1 cut(s) 188
AspLEI GCGC 1 cut(s) 108
AspS9I GGNCC 1 cut(s) 20
AsuHPI GGTGA 2 cut(s) 88, 127
AvaII GGWCC 1 cut(s) 20
BaeI ACNNNNGTAYC 2 cut(s) 154, 187
BbvI GCAGC 2 cut(s) 95, 239
BciT130I CCWGG 1 cut(s) 24
BfaI CTAG 1 cut(s) 146
BfoI RGCGCY 1 cut(s) 109
BisI GCNGC 2 cut(s) 109, 253
BlsI GCNGC 2 cut(s) 110, 254
Bme1390I CCNGG 1 cut(s) 24
Bme18I GGWCC 1 cut(s) 20
BmgT120I GGNCC 1 cut(s) 20
BmrFI CCNGG 1 cut(s) 24
BmsI GCATC 2 cut(s) 75, 237
BsaJI CCNNGG 1 cut(s) 216
Bse3DI GCAATG 1 cut(s) 81
BseBI CCWGG 1 cut(s) 24
BseDI CCNNGG 1 cut(s) 216
BseGI GGATG 2 cut(s) 66, 226
BseMI GCAATG 1 cut(s) 81
BseXI GCAGC 2 cut(s) 95, 239
BsgI GTGCAG 1 cut(s) 238
Bsp19I CCATGG 1 cut(s) 216
BsrDI GCAATG 1 cut(s) 81
BssECI CCNNGG 1 cut(s) 216
BssT1I CCWWGG 1 cut(s) 216
Bst2UI CCWGG 1 cut(s) 24
Bst6I CTCTTC 1 cut(s) 48
BstC8I GCNNGC 2 cut(s) 9, 64
BstDEI CTNAG 1 cut(s) 264
BstDSI CCRYGG 1 cut(s) 216
BstF5I GGATG 2 cut(s) 66, 226
BstH2I RGCGCY 1 cut(s) 109
BstHHI GCGC 1 cut(s) 108
BstMWI GCNNNNNNNGC 1 cut(s) 252
BstNI CCWGG 1 cut(s) 24
BstSCI CCNGG 1 cut(s) 22
BstV1I GCAGC 2 cut(s) 95, 239
BtgI CCRYGG 1 cut(s) 216
BtsCI GGATG 2 cut(s) 66, 226
Cac8I GCNNGC 2 cut(s) 9, 64
CfoI GCGC 1 cut(s) 108
Cfr13I GGNCC 1 cut(s) 20
Csp6I GTAC 2 cut(s) 163, 171
CviAII CATG 2 cut(s) 217, 249
CviJI RGCY 2 cut(s) 11, 27
CviKI_1 RGCY 2 cut(s) 11, 27
CviQI GTAC 2 cut(s) 163, 171
DdeI CTNAG 1 cut(s) 264
Eam1104I CTCTTC 1 cut(s) 48
EarI CTCTTC 1 cut(s) 48
Eco130I CCWWGG 1 cut(s) 216
Eco47I GGWCC 1 cut(s) 20
Eco47III AGCGCT 1 cut(s) 107
EcoRII CCWGG 1 cut(s) 22
EcoT14I CCWWGG 1 cut(s) 216
ErhI CCWWGG 1 cut(s) 216
FaeI CATG 2 cut(s) 220, 252
FaiI YATR 5 cut(s) 116, 118, 197, 218, 250
FalI AAGNNNNNCTT 2 cut(s) 95, 127
FatI CATG 2 cut(s) 216, 248
Fnu4HI GCNGC 2 cut(s) 109, 253
FokI GGATG 2 cut(s) 53, 233
Fsp4HI GCNGC 2 cut(s) 109, 253
FspBI CTAG 1 cut(s) 146
GlaI GCGC 1 cut(s) 107
GluI GCNGC 2 cut(s) 109, 253
HaeII RGCGCY 1 cut(s) 109
HhaI GCGC 1 cut(s) 108
Hin1II CATG 2 cut(s) 220, 252
Hin6I GCGC 1 cut(s) 106
HinP1I GCGC 1 cut(s) 106
HphI GGTGA 2 cut(s) 88, 127
Hpy166II GTNNAC 1 cut(s) 173
Hpy8I GTNNAC 1 cut(s) 173
HpyAV CCTTC 1 cut(s) 80
HpyCH4IV ACGT 1 cut(s) 152
HpyCH4V TGCA 3 cut(s) 81, 228, 255
HpyF10VI GCNNNNNNNGC 1 cut(s) 252
HpyF3I CTNAG 1 cut(s) 264
HpySE526I ACGT 1 cut(s) 152
Hsp92II CATG 2 cut(s) 220, 252
HspAI GCGC 1 cut(s) 106
LpnPI CCDG 4 cut(s) 9, 20, 36, 107
Lsp1109I GCAGC 2 cut(s) 95, 239
LweI GCATC 2 cut(s) 75, 237
MaeI CTAG 1 cut(s) 146
MaeII ACGT 1 cut(s) 152
MboII GAAGA 1 cut(s) 35
MluCI AATT 1 cut(s) 188
MseI TTAA 1 cut(s) 192
MspR9I CCNGG 1 cut(s) 24
MvaI CCWGG 1 cut(s) 24
MwoI GCNNNNNNNGC 1 cut(s) 252
NcoI CCATGG 1 cut(s) 216
NlaIII CATG 2 cut(s) 220, 252
PkrI GCNGC 2 cut(s) 110, 254
Psp6I CCWGG 1 cut(s) 22
PspGI CCWGG 1 cut(s) 22
PspPI GGNCC 1 cut(s) 20
PsrI GAACNNNNNNTAC 2 cut(s) 196, 228
RsaI GTAC 2 cut(s) 164, 172
RsaNI GTAC 2 cut(s) 163, 171
SaqAI TTAA 1 cut(s) 192
SatI GCNGC 2 cut(s) 109, 253
Sau96I GGNCC 1 cut(s) 20
ScrFI CCNGG 1 cut(s) 24
SetI ASST 3 cut(s) 13, 155, 240
SfaNI GCATC 2 cut(s) 75, 237
SinI GGWCC 1 cut(s) 20
Sse9I AATT 1 cut(s) 188
SspMI CTAG 1 cut(s) 146
StyD4I CCNGG 1 cut(s) 22
StyI CCWWGG 1 cut(s) 216
TaiI ACGT 1 cut(s) 155
TasI AATT 1 cut(s) 188
Tru1I TTAA 1 cut(s) 192
Tru9I TTAA 1 cut(s) 192
TseI GCWGC 2 cut(s) 108, 252
TspDTI ATGAA 2 cut(s) 17, 35
TspGWI ACGGA 1 cut(s) 158
VpaK11BI GGWCC 1 cut(s) 20
XapI RAATTY 1 cut(s) 188
XspI CTAG 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.