Rmu_sc0000226.1_g000018
NAC Family

proteinaceous RNase P 1, chloroplastic mitochondrial-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000226.1
OG0002433
Physical Location & Seq
Reverse (-)
71631 .. 83239
11609 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 5022 bp
atggcgggcgtcaaggtcaccttggaggtcggaagcgacggtgtcgccgtcatcaccatgttcaatcctcccgttaacgccttggccatatccattctcaaggggctgaaggagaagttcgatgaggccgcgaggagaaacgacgtcaaggctattgtcgttactggaaatggaggaaggttttctggaggttttgatatcaatgttttcgagaaggttcacgctaccggggatatttcgctcatgcctgatgtatctgttgacttgatggtcaacactgttgaagattcaaagaagcctgttgttgctgccgtggaaggacttgctctcggaggtggcttggagttggcattgggatgccatgctcgcattgctgctccaagaactcaactaggcctgccagagttgacacttggtgttattccgggatttggaggcacacagcgtcttccaaggcttgcggggcttccgaaggcagttgagatgatgctgttatccaagtcaatcatgtctgaagaaggggcaaagcttggtcttatcgatgctattgtgccttctcaagagttgctgaaagtatctcgattatgggctttggacattgcagcggcgcgaaaaccatggttacggtcccttcacaggacagataagctttgctccttatctgaggcacgcgagataattaaagttgctagacaacaagccagaaagacggctcccaatatgcctcagcatcaagtatgcctcgatgcaattgaagagggcattattcatggaggatatagtggagttctgaaggaagctaaggtttttaaggagttagttgtatcagacacttcaaaaggtcttgtacatgtattttttgcgcaacgggcaacatcaaaggtgcccaaggttactgatgttgggcttaaaccaaggcatataaagaaggttgctatcattgggggaggtctgatgggttctggcatagctacagcccttcttctgagcaatgtatctgttgttctcaaagaaatcaactctgaatttcttcagaagggtgtacgaacaatagaaggaaatgtcaaaggcttggtaactagagggaagctggcacgggataaggcagacaaagctctctcattgcttaaaggtagtctggactattcagacttcaaagatgtggatatggtcatagaggctgtcattgagagcgttcctctcaaacaaaagatttttggtgaacttgagaaagtttgcccttctcgttgcattttggctacaaacacatccactattgacctcaatatagttggagaaaagacgagatctcaggatcgcatcgtgggggcacactttttcagtcctgctcatgtgatgcctcttcttgaaatagtacggacagagaagacttcggcacaagtaattcttgaccttttgacggttggaaaagtaataaagaaagttcctgttgtggttggtaactgtacgggatttgcagtcaatcgggcattctttccctatacccaaggcgcacatatattggtcaattcaggtgtcgatgtgttcaggattgacaggatcatcagcaattttggccttcctatgggtccattccaacttcaggatttggcaggctatggagtagctcttgctgttggaaaggaatttgctagtgctttccctgatcgcacatttcaatcaccattggtcgaactcttagtcaaaaatggacgaaatggtaaaaacaatggaaaaggatattacacttatgaaaagggaagcaagcccaagcctgatctgtctgtgctaccaattattgaggagtctagacgaattaccaatatgatgcctggtggaaagcctttatctgttacagaccaagaaattctggagataatactctttcctgtggtgaatgaggcatgtcgtattttggatgaaggagtagttattcgagcagcagaccttgacattgcatctgttcttggcatgagtttcccaaattaccggggtggcattgtcttttgggcagatatggttgggcctaagcatatatacgctactctcaagaaatggtcaggagtatacggtggtttcttcaaaccatcaaggtttttggaagaaagagcaacaaaaggcttgcctctgagtgcacccgcatcatcctcatcttcaaggtcacgcatgttatcctcccgattacacccctccttcactcacaagctcaccaaaacgacgtcgtccgaactctcttccctcaaatcgagccttcactttccggcacccgctcccgtccgacgcatttccaggttaccattggaactgagcagcgtggagtcgatgatgccattgcacagtgcaattgcttcggcgcggttaacatcgagcttgtcaattgagtcccagagctggggattagtccctcaagttaatccatatcggtatcggcccagcaaactcctccaacggccacacatggcctccttcacctcccccaactcagtactgcagcaaaagcagcaccaccttcttcactccatcaccaccctctgtaagtacccatctcctctcaacgtttttgaattccactgcccctctcatttcttcactttctcacctcccaagcaaacacttcaactcaaacacgcactaaaactctatccacttccactagctagagagaatatcaaccacatagttgcaaagttttccacctccaccaccacgtaccatgaaccacacacaaagaccctgaactcagcaactgaaaaacctgtaaagaacaatggcagttcagttgtgaagaaaaagagtgaagctaggttcactaaagagaaaagtacaaagaaaagtagaaggaaggagggtatgtggtttaaagataagagtaaggaaagaaagaagagaggtagtgattgtgatcaggtgggagaagagaaaaaggggagagggtctaagaaaaacaaggttaatgtagacttgcctgaagttaagatgagagttggattggatatgtgctcaaagagaggggatgtaatgggtgcaattaagtactatgatttggctcaaattgagcagattaagttggatcagtatcattatactgttctgttgtatctgtgctcttctgcagctgttggtgttgttcgtcctgctaagagtgggtctgggactcgagttttggataccctggattcgtctggtgaaggaactggggtggaaacaatggagttgactaagttaagagattcgggtattgggaattgggatgataacagtggaagtgatgagagtgctgaaaaattggagttgagttcaaggaacaggtttgatgatgatgtggatggtgcttccaatgaaaagaggaacttagcgtggttttctaatggatttgtgaagcgaaactctcgcctgttagatggactgaacaatcctaccaaagttggagatgatggtacaagtctaaaagatggaaatttgaagcaagaaagcaatgagattcgggttagtgaggatgtgaagaagtatgcactccaaaggggatttgagatttatgagaagatgtgtttggatggtgtcccagtgaatgaagcagcattgacatctgtggctagaatggcaatgtcaatgggggagggagacatggcatttgacatggtgaagcagatgaaatcgatgggaataaatcctagactgcgttcctatggtcctgcgttatctgctttttgcagtagtggcaatattgacaaagcgtttgctgttgagaaacacatgttggagcatggtgtctatccagaagagcctgaactggaggccctcttaagagtgagtgtgggagctggaaaaggtgacaaggtgtataatatgttgcagaaactaagaacaagtgtaaggagggtctcaccctctactgctgacttaattgtaaagtggtttaatagcaaggaagcgtcgagagtgggaaagataaaatgggacgaaagattgataaggcaggccattgaaaatggaggtggtgggtggcatgggcagggatggttggggaaaggaaagtggtcagtgctacatacaactattggatccgatggcttgtgcaaatgctgtggggggaaattggccacaattgatcttgatcccgtagaaacagaaaactttgctgaatcagttgcatctatagctatacagagagagaaaaattcaagctttcagaaatttcaaaaatggcttgattattatggaccttttgaagcagtggtggatggagctaatgtaggtcttttcagccagaagaaattcatcacagccaaggtcaatgctgttgttaatggcatacgccagaagcttccttcgaagagatggccactcattgttcttcataataggcgtatcactggaggcagaatggatgaacgggtgaataaggcgttgattgagaagtggcaaaatgctgatgctctctatgcaacgcctactgggtcaaatgatgattggtactggttgtatgctgcaattaagttcaagtgcttacttgtgacaaatgatgagatgagagaccatacatttcaacttcttgggaatgatttctttccaagatggaaagaaaggcatcaagtgcacttcagtttctctgaaggtggtccagtgtttcatatgcctcctccttgttctgttgtaattcaggaatcagaggaagggcactggcacattccagtggtgtcagaacatggttatgaagctgaaagaatgtggttatgcattatgcgagctaaatcacgtgaggcaaggaaggattctgcaaccagacctgaagatgcagaacctcaaaacaagggatttgctaggtcagctaccagaactggcattgagtcacaaccgttgaaaattgcgaaccacaagtatactaaacaccgaccccaggaaattctcaagaatctcaaagatattctatcaggttccacaatctcgaatcatcgttccataataccagaaattgagactgcagagaagattggtggatgtaccattgactttcaaatatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03013 map03013
Pfam Domains
Protein Families
PPR_long PRORP

Protein Analysis

1673

Amino Acids

184.5

Weight (kDa)

9.38

Isoelectric Point (pI)

41.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ECH_1 PF00378 13 - 211 1.1e-38 Enoyl-CoA hydratase/isomerase
ECH_2 PF16113 25 - 199 4.1e-22 Enoyl-CoA hydratase/isomerase
3HCDH_N PF02737 310 - 488 5.8e-57 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain
3HCDH PF00725 491 - 584 1.3e-21 3-hydroxyacyl-CoA dehydrogenase, C-terminal domain
PPR_long PF17177 981 - 1044 9.1e-13 Pentacotripeptide-repeat region of PRORP
PPR_long PF17177 1167 - 1312 1.8e-52 Pentacotripeptide-repeat region of PRORP
TPR_24 PF23276 1193 - 1304 7e-07 Fungal tetratrico peptide repeats
PRORP PF16953 1353 - 1579 3.7e-80 Protein-only RNase P
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 269
AatII GACGTC 2 cut(s) 147, 2222
Acc16I TGCGCA 1 cut(s) 864
AccB1I GGYRCC 2 cut(s) 883, 2263
AccBSI CCGCTC 1 cut(s) 2270
AccI GTMKAC 3 cut(s) 2067, 2958, 4880
AccII CGCG 4 cut(s) 131, 610, 672, 2356
AciI CCGC 7 cut(s) 5, 129, 461, 605, 2139, 2268, 2356
AclI AACGTT 1 cut(s) 2556
AclWI GGATC 6 cut(s) 1323, 1568, 3078, 4056, 4069, 4109
AcoI YGGCCR 4 cut(s) 84, 2450, 4098, 4340
AcsI RAATTY 9 cut(s) 1025, 1646, 1866, 2564, 3457, 4177, 4193, 4274, 4902
AcuI CTGAAG 9 cut(s) 128, 534, 812, 1016, 1586, 2988, 4585, 4632, 4809
AcvI CACGTG 1 cut(s) 4757
AcyI GRCGYC 3 cut(s) 9, 144, 2219
AdeI CACNNNGTG 1 cut(s) 416
AfiI CCNNNNNNNGG 8 cut(s) 431, 636, 1420, 1585, 1603, 2391, 2392, 4897
AflII CTTAAG 1 cut(s) 3802
AflIII ACRYGT 2 cut(s) 850, 3753
AjnI CCWGG 4 cut(s) 1831, 2288, 3171, 4896
AjuI GAANNNNNNNTTGG 4 cut(s) 3533, 3565, 3740, 3772
Alw21I GWGCWC 4 cut(s) 2137, 3002, 3107, 4599
Alw26I GTCTC 4 cut(s) 3615, 3886, 4527, 4970
Alw44I GTGCAC 2 cut(s) 2133, 4595
AlwI GGATC 6 cut(s) 1323, 1568, 3078, 4056, 4069, 4109
AlwNI CAGNNNCTG 1 cut(s) 2747
Ama87I CYCGRG 1 cut(s) 3156
ApaLI GTGCAC 2 cut(s) 2133, 4595
ApoI RAATTY 9 cut(s) 1025, 1646, 1866, 2564, 3457, 4177, 4193, 4274, 4902
ArsI GACNNNNNNTTYG 8 cut(s) 1686, 1718, 3145, 3177, 3614, 3646, 3719, 3751
Asp700I GAANNNNTTC 4 cut(s) 181, 1029, 4274, 4562
AspLEI GCGC 4 cut(s) 610, 865, 1514, 2356
AspS9I GGNCC 8 cut(s) 627, 1589, 2024, 2430, 3689, 3796, 4220, 4619
AsuC2I CCSGG 3 cut(s) 229, 426, 1991
AsuII TTCGAA 1 cut(s) 4331
AvaI CYCGRG 1 cut(s) 3156
AvaII GGWCC 5 cut(s) 627, 1589, 3689, 4220, 4619
BaeGI GKGCMC 5 cut(s) 888, 1333, 2137, 4599, 4680
BalI TGGCCA 3 cut(s) 86, 4100, 4342
BamHI GGATCC 1 cut(s) 4061
BanI GGYRCC 2 cut(s) 883, 2263
BbrPI CACGTG 1 cut(s) 4757
BbsI GAAGAC 2 cut(s) 440, 1394
Bbv12I GWGCWC 4 cut(s) 2137, 3002, 3107, 4599
BbvCI CCTCAGC 1 cut(s) 726
BceAI ACGGC 4 cut(s) 32, 296, 726, 2465
BcgI CGANNNNNNTGC 2 cut(s) 2331, 2365
BciT130I CCWGG 4 cut(s) 1833, 2290, 3173, 4898
BciVI GTATCC 1 cut(s) 3160
BclI TGATCA 1 cut(s) 2902
BcnI CCSGG 3 cut(s) 229, 426, 1991
BcoDI GTCTC 4 cut(s) 3615, 3886, 4527, 4970
BfmI CTRYAG 5 cut(s) 972, 2489, 3111, 4155, 4980
BfrI CTTAAG 1 cut(s) 3802
BfuI GTATCC 1 cut(s) 3160
BglII AGATCT 1 cut(s) 1307
BmcAI AGTACT 2 cut(s) 2487, 3035
Bme1390I CCNGG 7 cut(s) 229, 426, 1833, 1991, 2290, 3173, 4898
Bme18I GGWCC 5 cut(s) 627, 1589, 3689, 4220, 4619
BmeT110I CYCGRG 1 cut(s) 3156
BmgT120I GGNCC 8 cut(s) 627, 1589, 2024, 2430, 3689, 3796, 4220, 4619
BmiI GGNNCC 7 cut(s) 629, 714, 885, 1590, 2265, 4063, 4936
BmrFI CCNGG 7 cut(s) 229, 426, 1833, 1991, 2290, 3173, 4898
BmrI ACTGGG 3 cut(s) 3204, 3557, 4464
BmuI ACTGGG 3 cut(s) 3204, 3557, 4464
BpiI GAAGAC 2 cut(s) 440, 1394
BplI GAGNNNNNCTC 2 cut(s) 1183, 1215
BpmI CTGGAG 4 cut(s) 207, 1892, 3812, 4395
Bpu10I CCTNAGC 3 cut(s) 726, 801, 2028
Bpu14I TTCGAA 1 cut(s) 4331
BpuEI CTTGAG 6 cut(s) 83, 543, 1247, 2033, 2391, 4892
BpuMI CCSGG 3 cut(s) 229, 426, 1991
Bsa29I ATCGAT 2 cut(s) 540, 3656
BsaAI YACGTR 2 cut(s) 2709, 4757
BsaBI GATNNNNATC 3 cut(s) 2901, 3075, 4113
BsaHI GRCGYC 3 cut(s) 9, 144, 2219
BsaI GGTCTC 2 cut(s) 3886, 4527
BsaXI ACNNNNNCTCC 6 cut(s) 2447, 2477, 2837, 2867, 4236, 4266
Bsc4I CCNNNNNNNGG 8 cut(s) 431, 636, 1420, 1585, 1603, 2391, 2392, 4897
Bse3DI GCAATG 8 cut(s) 369, 597, 997, 1121, 1953, 2330, 3481, 3609
Bse8I GATNNNNATC 3 cut(s) 2901, 3075, 4113
BseBI CCWGG 4 cut(s) 1833, 2290, 3173, 4898
BseCI ATCGAT 2 cut(s) 540, 3656
BseJI GATNNNNATC 3 cut(s) 2901, 3075, 4113
BseLI CCNNNNNNNGG 8 cut(s) 431, 636, 1420, 1585, 1603, 2391, 2392, 4897
BseMI GCAATG 8 cut(s) 369, 597, 997, 1121, 1953, 2330, 3481, 3609
BseMII CTCAG 8 cut(s) 654, 740, 977, 1325, 2120, 2297, 2496, 2754
BseRI GAGGAG 5 cut(s) 148, 1817, 2432, 2538, 4629
BseSI GKGCMC 5 cut(s) 888, 1333, 2137, 4599, 4680
BseYI CCCAGC 2 cut(s) 2391, 2432
Bsh1236I CGCG 4 cut(s) 131, 610, 672, 2356
BshNI GGYRCC 2 cut(s) 883, 2263
BshVI ATCGAT 2 cut(s) 540, 3656
BsiHKAI GWGCWC 4 cut(s) 2137, 3002, 3107, 4599
BsiHKCI CYCGRG 1 cut(s) 3156
BsiSI CCGG 4 cut(s) 228, 425, 1990, 2261
BslFI GGGAC 6 cut(s) 613, 2368, 2387, 3166, 3545, 3971
BslI CCNNNNNNNGG 8 cut(s) 431, 636, 1420, 1585, 1603, 2391, 2392, 4897
BsmAI GTCTC 4 cut(s) 3615, 3886, 4527, 4970
BsmFI GGGAC 6 cut(s) 613, 2368, 2387, 3166, 3545, 3971
BsmI GAATGC 1 cut(s) 1490
Bso31I GGTCTC 2 cut(s) 3886, 4527
BsoBI CYCGRG 1 cut(s) 3156
Bsp119I TTCGAA 1 cut(s) 4331
Bsp1286I GDGCHC 7 cut(s) 888, 1333, 2137, 3002, 3107, 4599, 4680
Bsp1407I TGTACA 1 cut(s) 847
Bsp19I CCATGG 1 cut(s) 617
BspACI CCGC 7 cut(s) 5, 129, 461, 605, 2139, 2268, 2356
BspCNI CTCAG 8 cut(s) 655, 739, 978, 1324, 2121, 2298, 2495, 2753
BspDI ATCGAT 2 cut(s) 540, 3656
BspFNI CGCG 4 cut(s) 131, 610, 672, 2356
BspLI GGNNCC 7 cut(s) 629, 714, 885, 1590, 2265, 4063, 4936
BspMAI CTGCAG 3 cut(s) 2493, 3115, 4984
BspPI GGATC 6 cut(s) 1323, 1568, 3078, 4056, 4069, 4109
BspQI GCTCTTC 2 cut(s) 3112, 3774
BspT104I TTCGAA 1 cut(s) 4331
BspT107I GGYRCC 2 cut(s) 883, 2263
BspTI CTTAAG 1 cut(s) 3802
BspTNI GGTCTC 2 cut(s) 3886, 4527
BsrBI CCGCTC 1 cut(s) 2270
BsrDI GCAATG 8 cut(s) 369, 597, 997, 1121, 1953, 2330, 3481, 3609
BsrGI TGTACA 1 cut(s) 847
BssNAI GTATAC 2 cut(s) 2068, 4881
BssNI GRCGYC 3 cut(s) 9, 144, 2219
BssT1I CCWWGG 8 cut(s) 21, 81, 452, 617, 888, 914, 1507, 4287
Bst1107I GTATAC 2 cut(s) 2068, 4881
Bst2UI CCWGG 4 cut(s) 1833, 2290, 3173, 4898
Bst6I CTCTTC 8 cut(s) 750, 1368, 2239, 2879, 2910, 3112, 3774, 4328
BstACI GRCGYC 3 cut(s) 9, 144, 2219
BstAFI CTTAAG 1 cut(s) 3802
BstAPI GCANNNNNTGC 1 cut(s) 4594
BstAUI TGTACA 1 cut(s) 847
BstBAI YACGTR 2 cut(s) 2709, 4757
BstBI TTCGAA 1 cut(s) 4331
BstDSI CCRYGG 2 cut(s) 312, 617
BstEII GGTNACC 2 cut(s) 16, 2292
BstFNI CGCG 4 cut(s) 131, 610, 672, 2356
BstHHI GCGC 4 cut(s) 610, 865, 1514, 2356
BstMAI GTCTC 4 cut(s) 3615, 3886, 4527, 4970
BstNI CCWGG 4 cut(s) 1833, 2290, 3173, 4898
BstNSI RCATGY 4 cut(s) 854, 1908, 2170, 3757
BstPI GGTNACC 2 cut(s) 16, 2292
BstSCI CCNGG 7 cut(s) 227, 424, 1831, 1989, 2288, 3171, 4896
BstSFI CTRYAG 5 cut(s) 972, 2489, 3111, 4155, 4980
BstSLI GKGCMC 5 cut(s) 888, 1333, 2137, 4599, 4680
BstUI CGCG 4 cut(s) 131, 610, 672, 2356
BstV2I GAAGAC 2 cut(s) 440, 1394
BstX2I RGATCY 2 cut(s) 1307, 4061
BstYI RGATCY 2 cut(s) 1307, 4061
BstZ17I GTATAC 2 cut(s) 2068, 4881
Bsu15I ATCGAT 2 cut(s) 540, 3656
BsuI GTATCC 1 cut(s) 3160
BsuTUI ATCGAT 2 cut(s) 540, 3656
BtgI CCRYGG 2 cut(s) 312, 617
BtsI GCAGTG 2 cut(s) 2569, 4239
CaiI CAGNNNCTG 1 cut(s) 2747
CfoI GCGC 4 cut(s) 610, 865, 1514, 2356
Cfr13I GGNCC 8 cut(s) 627, 1589, 2024, 2430, 3689, 3796, 4220, 4619
ClaI ATCGAT 2 cut(s) 540, 3656
CseI GACGC 3 cut(s) 434, 2289, 3921
CspCI CAANNNNNGTGG 2 cut(s) 4066, 4101
DraI TTTAAA 1 cut(s) 2860
DraIII CACNNNGTG 1 cut(s) 416
DrdI GACNNNNNNGTC 1 cut(s) 269
DseDI GACNNNNNNGTC 1 cut(s) 269
EaeI YGGCCR 4 cut(s) 84, 2450, 4098, 4340
Eam1104I CTCTTC 8 cut(s) 750, 1368, 2239, 2879, 2910, 3112, 3774, 4328
EarI CTCTTC 8 cut(s) 750, 1368, 2239, 2879, 2910, 3112, 3774, 4328
Eco130I CCWWGG 8 cut(s) 21, 81, 452, 617, 888, 914, 1507, 4287
Eco147I AGGCCT 1 cut(s) 396
Eco31I GGTCTC 2 cut(s) 3886, 4527
Eco32I GATATC 1 cut(s) 199
Eco47I GGWCC 5 cut(s) 627, 1589, 3689, 4220, 4619
Eco57I CTGAAG 9 cut(s) 128, 534, 812, 1016, 1586, 2988, 4585, 4632, 4809
Eco72I CACGTG 1 cut(s) 4757
Eco88I CYCGRG 1 cut(s) 3156
Eco91I GGTNACC 2 cut(s) 16, 2292
EcoO109I RGGNCCY 1 cut(s) 3796
EcoO65I GGTNACC 2 cut(s) 16, 2292
EcoRI GAATTC 1 cut(s) 2564
EcoRII CCWGG 4 cut(s) 1831, 2288, 3171, 4896
EcoRV GATATC 1 cut(s) 199
EcoT14I CCWWGG 8 cut(s) 21, 81, 452, 617, 888, 914, 1507, 4287
EcoT22I ATGCAT 1 cut(s) 4739
ErhI CCWWGG 8 cut(s) 21, 81, 452, 617, 888, 914, 1507, 4287
FalI AAGNNNNNCTT 5 cut(s) 37, 1392, 1424, 3335, 3367
FaqI GGGAC 6 cut(s) 613, 2368, 2387, 3166, 3545, 3971
FauI CCCGC 3 cut(s) 454, 2146, 2275
FauNDI CATATG 1 cut(s) 4632
FbaI TGATCA 1 cut(s) 2902
FblI GTMKAC 3 cut(s) 2067, 2958, 4880
FspI TGCGCA 1 cut(s) 864
GlaI GCGC 4 cut(s) 609, 864, 1513, 2355
GsaI CCCAGC 2 cut(s) 2395, 2436
GsuI CTGGAG 4 cut(s) 207, 1892, 3812, 4395
HapII CCGG 4 cut(s) 228, 425, 1990, 2261
HgaI GACGC 3 cut(s) 434, 2289, 3921
HhaI GCGC 4 cut(s) 610, 865, 1514, 2356
Hin1I GRCGYC 3 cut(s) 9, 144, 2219
Hin6I GCGC 4 cut(s) 608, 863, 1512, 2354
HinP1I GCGC 4 cut(s) 608, 863, 1512, 2354
HincII GTYRAC 6 cut(s) 76, 262, 274, 408, 2361, 3216
HindII GTYRAC 6 cut(s) 76, 262, 274, 408, 2361, 3216
HindIII AAGCTT 4 cut(s) 527, 647, 4183, 4322
HpaI GTTAAC 2 cut(s) 76, 2361
HpaII CCGG 4 cut(s) 228, 425, 1990, 2261
Hpy99I CGWCG 6 cut(s) 41, 146, 2221, 2224, 2283, 3937
HpyCH4IV ACGT 5 cut(s) 144, 2219, 2556, 2708, 4756
HpySE526I ACGT 5 cut(s) 144, 2219, 2556, 2708, 4756
Hsp92I GRCGYC 3 cut(s) 9, 144, 2219
HspAI GCGC 4 cut(s) 608, 863, 1512, 2354
Ksp22I TGATCA 1 cut(s) 2902
KspAI GTTAAC 2 cut(s) 76, 2361
LguI GCTCTTC 2 cut(s) 3112, 3774
LmnI GCTCC 7 cut(s) 382, 659, 718, 2275, 3760, 3818, 4244
MaeII ACGT 5 cut(s) 144, 2219, 2556, 2708, 4756
MbiI CCGCTC 1 cut(s) 2270
MfeI CAATTG 4 cut(s) 750, 2343, 2376, 4104
MflI RGATCY 2 cut(s) 1307, 4061
MhlI GDGCHC 7 cut(s) 888, 1333, 2137, 3002, 3107, 4599, 4680
MlsI TGGCCA 3 cut(s) 86, 4100, 4342
MluNI TGGCCA 3 cut(s) 86, 4100, 4342
MlyI GAGTC 5 cut(s) 1814, 2327, 2390, 3148, 4856
Mox20I TGGCCA 3 cut(s) 86, 4100, 4342
Mph1103I ATGCAT 1 cut(s) 4739
MroXI GAANNNNTTC 4 cut(s) 181, 1029, 4274, 4562
MscI TGGCCA 3 cut(s) 86, 4100, 4342
MslI CAYNNNNRTG 4 cut(s) 56, 355, 4691, 4710
Msp20I TGGCCA 3 cut(s) 86, 4100, 4342
MspA1I CMGCKG 2 cut(s) 605, 3116
MspCI CTTAAG 1 cut(s) 3802
MspI CCGG 4 cut(s) 228, 425, 1990, 2261
MspR9I CCNGG 7 cut(s) 229, 426, 1833, 1991, 2290, 3173, 4898
MunI CAATTG 4 cut(s) 750, 2343, 2376, 4104
Mva1269I GAATGC 1 cut(s) 1490
MvaI CCWGG 4 cut(s) 1833, 2290, 3173, 4898
MvnI CGCG 4 cut(s) 131, 610, 672, 2356
NciI CCSGG 3 cut(s) 229, 426, 1991
NcoI CCATGG 1 cut(s) 617
NdeI CATATG 1 cut(s) 4632
NlaIV GGNNCC 7 cut(s) 629, 714, 885, 1590, 2265, 4063, 4936
NmuCI GTSAC 5 cut(s) 16, 2160, 3830, 4513, 4848
NsbI TGCGCA 1 cut(s) 864
NsiI ATGCAT 1 cut(s) 4739
NspI RCATGY 4 cut(s) 854, 1908, 2170, 3757
NspV TTCGAA 1 cut(s) 4331
PaeR7I CTCGAG 1 cut(s) 3156
PceI AGGCCT 1 cut(s) 396
PciI ACATGT 2 cut(s) 850, 3753
PciSI GCTCTTC 2 cut(s) 3112, 3774
PcsI WCGNNNNNNNCGW 1 cut(s) 45
PctI GAATGC 1 cut(s) 1490
PdmI GAANNNNTTC 4 cut(s) 181, 1029, 4274, 4562
PfeI GAWTC 9 cut(s) 287, 3176, 3230, 3481, 4142, 4664, 4772, 4912, 4948
PflFI GACNNNGTC 2 cut(s) 41, 2221
PfoI TCCNGGA 1 cut(s) 424
PleI GAGTC 5 cut(s) 1813, 2326, 2389, 3148, 4855
PmaCI CACGTG 1 cut(s) 4757
PmlI CACGTG 1 cut(s) 4757
PpsI GAGTC 5 cut(s) 1813, 2326, 2389, 3148, 4855
Ppu21I YACGTR 2 cut(s) 2709, 4757
PscI ACATGT 2 cut(s) 850, 3753
Psp1406I AACGTT 1 cut(s) 2556
Psp6I CCWGG 4 cut(s) 1831, 2288, 3171, 4896
PspCI CACGTG 1 cut(s) 4757
PspEI GGTNACC 2 cut(s) 16, 2292
PspFI CCCAGC 2 cut(s) 2391, 2432
PspGI CCWGG 4 cut(s) 1831, 2288, 3171, 4896
PspN4I GGNNCC 7 cut(s) 629, 714, 885, 1590, 2265, 4063, 4936
PspPI GGNCC 8 cut(s) 627, 1589, 2024, 2430, 3689, 3796, 4220, 4619
PspXI VCTCGAGB 1 cut(s) 3156
PsrI GAACNNNNNNTAC 2 cut(s) 987, 1019
PstI CTGCAG 3 cut(s) 2493, 3115, 4984
PstNI CAGNNNCTG 1 cut(s) 2747
PsuI RGATCY 2 cut(s) 1307, 4061
PsyI GACNNNGTC 2 cut(s) 41, 2221
PvuII CAGCTG 1 cut(s) 3116
RseI CAYNNNNRTG 4 cut(s) 56, 355, 4691, 4710
SapI GCTCTTC 2 cut(s) 3112, 3774
Sau96I GGNCC 8 cut(s) 627, 1589, 2024, 2430, 3689, 3796, 4220, 4619
ScaI AGTACT 2 cut(s) 2487, 3035
SchI GAGTC 5 cut(s) 1814, 2327, 2390, 3148, 4856
ScrFI CCNGG 7 cut(s) 229, 426, 1833, 1991, 2290, 3173, 4898
SduI GDGCHC 7 cut(s) 888, 1333, 2137, 3002, 3107, 4599, 4680
SfcI CTRYAG 5 cut(s) 972, 2489, 3111, 4155, 4980
Sfr274I CTCGAG 1 cut(s) 3156
SfuI TTCGAA 1 cut(s) 4331
SinI GGWCC 5 cut(s) 627, 1589, 3689, 4220, 4619
SlaI CTCGAG 1 cut(s) 3156
SmiMI CAYNNNNRTG 4 cut(s) 56, 355, 4691, 4710
SmlI CTYRAG 8 cut(s) 98, 558, 1226, 2048, 2406, 3156, 3802, 4907
SmoI CTYRAG 8 cut(s) 98, 558, 1226, 2048, 2406, 3156, 3802, 4907
SseBI AGGCCT 1 cut(s) 396
SsiI CCGC 7 cut(s) 5, 129, 461, 605, 2139, 2268, 2356
SspI AATATT 1 cut(s) 3724
StuI AGGCCT 1 cut(s) 396
StyD4I CCNGG 7 cut(s) 227, 424, 1831, 1989, 2288, 3171, 4896
StyI CCWWGG 8 cut(s) 21, 81, 452, 617, 888, 914, 1507, 4287
TaiI ACGT 5 cut(s) 147, 2222, 2559, 2711, 4759
TatI WGTACW 4 cut(s) 847, 2485, 2822, 3033
TauI GCSGC 2 cut(s) 131, 608
TfiI GAWTC 9 cut(s) 287, 3176, 3230, 3481, 4142, 4664, 4772, 4912, 4948
TseFI GTSAC 5 cut(s) 16, 2160, 3830, 4513, 4848
Tsp45I GTSAC 5 cut(s) 16, 2160, 3830, 4513, 4848
TspGWI ACGGA 1 cut(s) 1393
Tth111I GACNNNGTC 2 cut(s) 41, 2221
Vha464I CTTAAG 1 cut(s) 3802
VneI GTGCAC 2 cut(s) 2133, 4595
VpaK11BI GGWCC 5 cut(s) 627, 1589, 3689, 4220, 4619
XapI RAATTY 9 cut(s) 1025, 1646, 1866, 2564, 3457, 4177, 4193, 4274, 4902
XbaI TCTAGA 1 cut(s) 1808
XceI RCATGY 4 cut(s) 854, 1908, 2170, 3757
XcmI CCANNNNNNNNNTGG 1 cut(s) 2296
XhoI CTCGAG 1 cut(s) 3156
XmiI GTMKAC 3 cut(s) 2067, 2958, 4880
XmnI GAANNNNTTC 4 cut(s) 181, 1029, 4274, 4562
ZraI GACGTC 2 cut(s) 145, 2220
ZrmI AGTACT 2 cut(s) 2487, 3035
Zsp2I ATGCAT 1 cut(s) 4739
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.