Rmu_sc0000523.1_g000002

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000523.1
Physical Location & Seq
Reverse (-)
49092 .. 49973
882 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000523.1_g000002.1.cds

Sequence Viewer

Length: 405 bp
atggccccaagagttggaacccacgtaaaacgccgcctgagccgccgagactggacggaacttccgggcgtcgttacggcatcgatactgtcacgtctcggagacatcgagtccttgacggtggctgagatggtgtgcaagacgtggcatgaaatctgcaaagaccctatgctgtggcgcaccatcgacttcatgagcaaccatacaaagttcatgttcgggccgccgttgcgttacgatatagtgcagatgtgtccacgtgccatacaccgtagctctggtagttctgtctacgtcaacgtcgactacttttgcaacaatgaactgttaaagtatatcaccaacagagcgggtcgctcttcaatacgtcgccatcatgaacccggatatgggttcattcattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

134

Amino Acids

15.57

Weight (kDa)

9.58

Isoelectric Point (pI)

56.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 14
AccBSI CCGCTC 1 cut(s) 350
AccI GTMKAC 2 cut(s) 291, 303
AciI CCGC 4 cut(s) 34, 43, 224, 350
AcvI CACGTG 1 cut(s) 260
AcyI GRCGYC 1 cut(s) 69
AfiI CCNNNNNNNGG 3 cut(s) 14, 389, 390
AgsI TTSAA 1 cut(s) 363
AhdI GACNNNNNGTC 1 cut(s) 109
AjiI CACGTC 2 cut(s) 95, 144
AluBI AGCT 1 cut(s) 276
AluI AGCT 1 cut(s) 276
Alw26I GTCTC 3 cut(s) 42, 96, 101
AoxI GGCC 2 cut(s) 3, 221
AspLEI GCGC 1 cut(s) 180
AspS9I GGNCC 2 cut(s) 4, 221
AsuC2I CCSGG 2 cut(s) 66, 384
AsuHPI GGTGA 1 cut(s) 331
BbrPI CACGTG 1 cut(s) 260
BccI CCATC 3 cut(s) 124, 191, 381
BceAI ACGGC 2 cut(s) 93, 211
BcnI CCSGG 2 cut(s) 66, 384
BcoDI GTCTC 3 cut(s) 42, 96, 101
BisI GCNGC 3 cut(s) 34, 43, 224
BlsI GCNGC 3 cut(s) 35, 44, 225
Bme1390I CCNGG 2 cut(s) 66, 384
BmeRI GACNNNNNGTC 1 cut(s) 109
BmgBI CACGTC 2 cut(s) 95, 144
BmgT120I GGNCC 2 cut(s) 4, 221
BmiI GGNNCC 2 cut(s) 6, 19
BmrFI CCNGG 2 cut(s) 66, 384
BmsI GCATC 1 cut(s) 89
Bpu10I CCTNAGC 1 cut(s) 38
BpuMI CCSGG 2 cut(s) 66, 384
Bsa29I ATCGAT 1 cut(s) 83
BsaAI YACGTR 2 cut(s) 25, 260
BsaHI GRCGYC 1 cut(s) 69
Bsc4I CCNNNNNNNGG 3 cut(s) 14, 389, 390
Bse1I ACTGG 1 cut(s) 56
BseCI ATCGAT 1 cut(s) 83
BseLI CCNNNNNNNGG 3 cut(s) 14, 389, 390
BseMII CTCAG 2 cut(s) 29, 117
BseNI ACTGG 1 cut(s) 56
BsgI GTGCAG 1 cut(s) 266
BshFI GGCC 2 cut(s) 5, 223
BshVI ATCGAT 1 cut(s) 83
BsiSI CCGG 2 cut(s) 65, 384
BslI CCNNNNNNNGG 3 cut(s) 14, 389, 390
BsmAI GTCTC 3 cut(s) 42, 96, 101
BsmBI CGTCTC 1 cut(s) 101
BsnI GGCC 2 cut(s) 5, 223
BspACI CCGC 4 cut(s) 34, 43, 224, 350
BspANI GGCC 2 cut(s) 5, 223
BspCNI CTCAG 2 cut(s) 30, 118
BspDI ATCGAT 1 cut(s) 83
BspHI TCATGA 2 cut(s) 192, 376
BspLI GGNNCC 2 cut(s) 6, 19
BspQI GCTCTTC 1 cut(s) 364
BsrBI CCGCTC 1 cut(s) 350
BsrI ACTGG 1 cut(s) 56
BssNI GRCGYC 1 cut(s) 69
Bst4CI ACNGT 4 cut(s) 90, 121, 272, 327
Bst6I CTCTTC 1 cut(s) 364
BstACI GRCGYC 1 cut(s) 69
BstBAI YACGTR 2 cut(s) 25, 260
BstDEI CTNAG 2 cut(s) 38, 126
BstHHI GCGC 1 cut(s) 180
BstMAI GTCTC 3 cut(s) 42, 96, 101
BstMWI GCNNNNNNNGC 3 cut(s) 39, 42, 229
BstSCI CCNGG 2 cut(s) 64, 382
Bsu15I ATCGAT 1 cut(s) 83
BsuRI GGCC 2 cut(s) 5, 223
BsuTUI ATCGAT 1 cut(s) 83
BtrI CACGTC 2 cut(s) 95, 144
CciI TCATGA 2 cut(s) 192, 376
CfoI GCGC 1 cut(s) 180
Cfr13I GGNCC 2 cut(s) 4, 221
ClaI ATCGAT 1 cut(s) 83
CseI GACGC 1 cut(s) 58
CviAII CATG 4 cut(s) 149, 193, 214, 377
CviJI RGCY 5 cut(s) 5, 42, 125, 223, 276
CviKI_1 RGCY 5 cut(s) 5, 42, 125, 223, 276
DdeI CTNAG 2 cut(s) 38, 126
DriI GACNNNNNGTC 1 cut(s) 109
Eam1104I CTCTTC 1 cut(s) 364
Eam1105I GACNNNNNGTC 1 cut(s) 109
EarI CTCTTC 1 cut(s) 364
Eco72I CACGTG 1 cut(s) 260
Esp3I CGTCTC 1 cut(s) 101
FaeI CATG 4 cut(s) 152, 196, 217, 380
FatI CATG 4 cut(s) 148, 192, 213, 376
FauI CCCGC 1 cut(s) 343
FblI GTMKAC 2 cut(s) 291, 303
Fnu4HI GCNGC 3 cut(s) 34, 43, 224
Fsp4HI GCNGC 3 cut(s) 34, 43, 224
GlaI GCGC 1 cut(s) 179
GluI GCNGC 3 cut(s) 34, 43, 224
HaeIII GGCC 2 cut(s) 5, 223
HapII CCGG 2 cut(s) 65, 384
HgaI GACGC 1 cut(s) 58
HhaI GCGC 1 cut(s) 180
Hin1I GRCGYC 1 cut(s) 69
Hin1II CATG 4 cut(s) 152, 196, 217, 380
Hin6I GCGC 1 cut(s) 178
HinP1I GCGC 1 cut(s) 178
HincII GTYRAC 2 cut(s) 298, 304
HindII GTYRAC 2 cut(s) 298, 304
HinfI GANTC 1 cut(s) 110
HpaII CCGG 2 cut(s) 65, 384
HphI GGTGA 1 cut(s) 331
Hpy166II GTNNAC 4 cut(s) 257, 292, 298, 304
Hpy188I TCNGA 1 cut(s) 101
Hpy188III TCNNGA 2 cut(s) 193, 377
Hpy8I GTNNAC 4 cut(s) 257, 292, 298, 304
Hpy99I CGWCG 3 cut(s) 74, 305, 372
HpyCH4III ACNGT 4 cut(s) 90, 121, 272, 327
HpyCH4IV ACGT 7 cut(s) 24, 94, 143, 259, 294, 300, 367
HpyCH4V TGCA 4 cut(s) 138, 159, 247, 315
HpyF10VI GCNNNNNNNGC 3 cut(s) 39, 42, 229
HpyF3I CTNAG 2 cut(s) 38, 126
HpySE526I ACGT 7 cut(s) 24, 94, 143, 259, 294, 300, 367
Hsp92I GRCGYC 1 cut(s) 69
Hsp92II CATG 4 cut(s) 152, 196, 217, 380
HspAI GCGC 1 cut(s) 178
LguI GCTCTTC 1 cut(s) 364
LpnPI CCDG 5 cut(s) 37, 50, 78, 264, 397
LweI GCATC 1 cut(s) 89
MaeII ACGT 7 cut(s) 24, 94, 143, 259, 294, 300, 367
MaeIII GTNAC 3 cut(s) 73, 90, 233
MbiI CCGCTC 1 cut(s) 350
MboII GAAGA 1 cut(s) 351
MlyI GAGTC 1 cut(s) 119
MseI TTAA 2 cut(s) 329, 403
MspI CCGG 2 cut(s) 65, 384
MspR9I CCNGG 2 cut(s) 66, 384
MwoI GCNNNNNNNGC 3 cut(s) 39, 42, 229
NciI CCSGG 2 cut(s) 66, 384
NlaIII CATG 4 cut(s) 152, 196, 217, 380
NlaIV GGNNCC 2 cut(s) 6, 19
NmeAIII GCCGAG 1 cut(s) 71
NmuCI GTSAC 1 cut(s) 90
PagI TCATGA 2 cut(s) 192, 376
PciSI GCTCTTC 1 cut(s) 364
PcsI WCGNNNNNNNCGW 2 cut(s) 105, 300
PflMI CCANNNNNTGG 1 cut(s) 14
PkrI GCNGC 3 cut(s) 35, 44, 225
PleI GAGTC 1 cut(s) 118
PmaCI CACGTG 1 cut(s) 260
PmlI CACGTG 1 cut(s) 260
PpsI GAGTC 1 cut(s) 118
Ppu21I YACGTR 2 cut(s) 25, 260
PspCI CACGTG 1 cut(s) 260
PspN4I GGNNCC 2 cut(s) 6, 19
PspPI GGNCC 2 cut(s) 4, 221
SalI GTCGAC 1 cut(s) 302
SapI GCTCTTC 1 cut(s) 364
SaqAI TTAA 2 cut(s) 329, 403
SatI GCNGC 3 cut(s) 34, 43, 224
Sau96I GGNCC 2 cut(s) 4, 221
SchI GAGTC 1 cut(s) 119
ScrFI CCNGG 2 cut(s) 66, 384
SetI ASST 8 cut(s) 27, 97, 146, 262, 278, 297, 303, 370
SfaNI GCATC 1 cut(s) 89
SsiI CCGC 4 cut(s) 34, 43, 224, 350
StyD4I CCNGG 2 cut(s) 64, 382
TaaI ACNGT 4 cut(s) 90, 121, 272, 327
TaiI ACGT 7 cut(s) 27, 97, 146, 262, 297, 303, 370
TaqI TCGA 4 cut(s) 83, 108, 186, 303
TauI GCSGC 3 cut(s) 36, 45, 226
Tru1I TTAA 2 cut(s) 329, 403
Tru9I TTAA 2 cut(s) 329, 403
TseFI GTSAC 1 cut(s) 90
Tsp45I GTSAC 1 cut(s) 90
TspDTI ATGAA 7 cut(s) 165, 181, 202, 336, 385, 389, 393
TspGWI ACGGA 1 cut(s) 71
Van91I CCANNNNNTGG 1 cut(s) 14
XmiI GTMKAC 2 cut(s) 291, 303
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.