Rmu_sc0000689.1_g000011

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000689.1
Physical Location & Seq
Forward (+)
30305 .. 30712
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000689.1_g000011.1.cds

Sequence Viewer

Length: 408 bp
atggttattgcttctactactgcattagtttgtggtgataaaagtatagaagttgtaggtggtgtttttgatggattaaaccctgatgaaagcaaggtatgtcaggagttgctttatgatggcattgatattcatactggttatcttggagatgcttcaacaaacttgtcaagttgcaatttttcccagccaaaagttaaacagcatatagagaaaaagggtgctgagagggcttcattgctaatcaagtctatgtcacaattcaatgatattgacttcctcttgaatcctcggatgacagctacagatggaaatagtgattgtgcagttgtggaagttgataagattggtccttgtaccaagggagaacaatctcattctatatgtgctcaagtgaatagaaattag

Protein Analysis

135

Amino Acids

14.5

Weight (kDa)

4.9

Isoelectric Point (pI)

30.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 358
AgsI TTSAA 3 cut(s) 159, 265, 286
AluBI AGCT 1 cut(s) 302
AluI AGCT 1 cut(s) 302
Alw21I GWGCWC 1 cut(s) 391
AspS9I GGNCC 1 cut(s) 350
AsuHPI GGTGA 1 cut(s) 47
AvaII GGWCC 1 cut(s) 350
Bbv12I GWGCWC 1 cut(s) 391
BccI CCATC 3 cut(s) 65, 113, 302
BfmI CTRYAG 1 cut(s) 303
Bme18I GGWCC 1 cut(s) 350
BmgT120I GGNCC 1 cut(s) 350
BmsI GCATC 1 cut(s) 142
BpuEI CTTGAG 1 cut(s) 375
BsaJI CCNNGG 2 cut(s) 290, 360
Bse1I ACTGG 1 cut(s) 142
Bse3DI GCAATG 1 cut(s) 236
BseDI CCNNGG 2 cut(s) 290, 360
BseGI GGATG 1 cut(s) 300
BseMI GCAATG 1 cut(s) 236
BseMII CTCAG 1 cut(s) 216
BseNI ACTGG 1 cut(s) 142
BseYI CCCAGC 1 cut(s) 186
BsgI GTGCAG 1 cut(s) 345
BsiHKAI GWGCWC 1 cut(s) 391
Bsp1286I GDGCHC 1 cut(s) 391
BspCNI CTCAG 1 cut(s) 217
BsrDI GCAATG 1 cut(s) 236
BsrI ACTGG 1 cut(s) 142
BssECI CCNNGG 2 cut(s) 290, 360
BssT1I CCWWGG 1 cut(s) 360
BstDEI CTNAG 1 cut(s) 225
BstF5I GGATG 1 cut(s) 300
BstMWI GCNNNNNNNGC 1 cut(s) 230
BstSFI CTRYAG 1 cut(s) 303
BtsCI GGATG 1 cut(s) 300
Cfr13I GGNCC 1 cut(s) 350
Csp6I GTAC 1 cut(s) 357
CviJI RGCY 3 cut(s) 190, 233, 302
CviKI_1 RGCY 3 cut(s) 190, 233, 302
CviQI GTAC 1 cut(s) 357
DdeI CTNAG 1 cut(s) 225
Eco130I CCWWGG 1 cut(s) 360
Eco47I GGWCC 1 cut(s) 350
EcoT14I CCWWGG 1 cut(s) 360
ErhI CCWWGG 1 cut(s) 360
FaiI YATR 9 cut(s) 47, 100, 117, 135, 207, 209, 254, 383, 385
FokI GGATG 1 cut(s) 307
GsaI CCCAGC 1 cut(s) 190
HinfI GANTC 1 cut(s) 286
HphI GGTGA 1 cut(s) 47
Hpy188I TCNGA 1 cut(s) 294
Hpy188III TCNNGA 2 cut(s) 104, 283
HpyCH4V TGCA 3 cut(s) 23, 177, 326
HpyF10VI GCNNNNNNNGC 1 cut(s) 230
HpyF3I CTNAG 1 cut(s) 225
LpnPI CCDG 4 cut(s) 89, 96, 123, 200
LweI GCATC 1 cut(s) 142
MaeIII GTNAC 1 cut(s) 255
MhlI GDGCHC 1 cut(s) 391
MluCI AATT 3 cut(s) 178, 260, 403
MnlI CCTC 3 cut(s) 222, 290, 300
MseI TTAA 2 cut(s) 77, 198
MwoI GCNNNNNNNGC 1 cut(s) 230
NmuCI GTSAC 1 cut(s) 255
PfeI GAWTC 1 cut(s) 286
PspFI CCCAGC 1 cut(s) 186
PspPI GGNCC 1 cut(s) 350
RsaI GTAC 1 cut(s) 358
RsaNI GTAC 1 cut(s) 357
SaqAI TTAA 2 cut(s) 77, 198
Sau96I GGNCC 1 cut(s) 350
SduI GDGCHC 1 cut(s) 391
SetI ASST 3 cut(s) 61, 99, 304
SfaNI GCATC 1 cut(s) 142
SfcI CTRYAG 1 cut(s) 303
SinI GGWCC 1 cut(s) 350
SmlI CTYRAG 1 cut(s) 390
SmoI CTYRAG 1 cut(s) 390
Sse9I AATT 3 cut(s) 178, 260, 403
StyI CCWWGG 1 cut(s) 360
TasI AATT 3 cut(s) 178, 260, 403
TfiI GAWTC 1 cut(s) 286
Tru1I TTAA 2 cut(s) 77, 198
Tru9I TTAA 2 cut(s) 77, 198
TseFI GTSAC 1 cut(s) 255
Tsp45I GTSAC 1 cut(s) 255
TspDTI ATGAA 3 cut(s) 102, 122, 225
VpaK11BI GGWCC 1 cut(s) 350
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.