Rmu_sc0001074.1_g000005

methyl-CpG-binding domain-containing protein 2-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001074.1
Physical Location & Seq
Forward (+)
30010 .. 31502
1493 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001074.1_g000005.1.cds

Sequence Viewer

Length: 423 bp
atgaccactcacgattcaagttattatcaagctctgttgggcaagagacttcgatccatggtggaagtccaaaagtatttgattgaacatcctgagtatatggtggatggtctatctatggtggcacaattttcatttcaaattccaaagcctgtacaggagaaatatgtgaggaaacgccctgcggctcctcggttgacagcagctgcccatgccagtagaactcttgaacctactgaagcaaatcccatagcaagggctggtccagatgatatagagttgctacttggttctccgtacttggaggctcatgtgtttgaccctgttggtcgacctacaaagaagcgagccaaaacaagaactccatcaagggtctcatttaaatatcagcacagagtcaagctaaaagggcttatgtcatga

Protein Analysis

140

Amino Acids

15.89

Weight (kDa)

9.99

Isoelectric Point (pI)

49.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 331
AciI CCGC 1 cut(s) 185
AclWI GGATC 1 cut(s) 48
AcsI RAATTY 1 cut(s) 141
AcuI CTGAAG 1 cut(s) 258
AfaI GTAC 2 cut(s) 156, 299
AfiI CCNNNNNNNGG 1 cut(s) 255
AgsI TTSAA 4 cut(s) 18, 86, 140, 230
AluBI AGCT 3 cut(s) 32, 206, 403
AluI AGCT 3 cut(s) 32, 206, 403
Alw26I GTCTC 2 cut(s) 40, 379
AlwI GGATC 1 cut(s) 48
AlwNI CAGNNNCTG 1 cut(s) 206
ApeKI GCWGC 2 cut(s) 203, 206
ApoI RAATTY 1 cut(s) 141
AspS9I GGNCC 1 cut(s) 263
AvaII GGWCC 1 cut(s) 263
BbvI GCAGC 2 cut(s) 193, 215
BccI CCATC 2 cut(s) 101, 373
BcoDI GTCTC 2 cut(s) 40, 379
BisI GCNGC 3 cut(s) 186, 204, 207
BlsI GCNGC 3 cut(s) 187, 205, 208
Bme18I GGWCC 1 cut(s) 263
BmgT120I GGNCC 1 cut(s) 263
BmiI GGNNCC 1 cut(s) 189
BsaI GGTCTC 1 cut(s) 379
BsaJI CCNNGG 2 cut(s) 57, 191
BsaXI ACNNNNNCTCC 2 cut(s) 346, 376
Bsc4I CCNNNNNNNGG 1 cut(s) 255
Bse1I ACTGG 1 cut(s) 216
BseDI CCNNGG 2 cut(s) 57, 191
BseGI GGATG 2 cut(s) 88, 112
BseLI CCNNNNNNNGG 1 cut(s) 255
BseMII CTCAG 1 cut(s) 84
BseNI ACTGG 1 cut(s) 216
BseRI GAGGAG 1 cut(s) 180
BseXI GCAGC 2 cut(s) 193, 215
BslI CCNNNNNNNGG 1 cut(s) 255
BsmAI GTCTC 2 cut(s) 40, 379
Bso31I GGTCTC 1 cut(s) 379
Bsp1407I TGTACA 1 cut(s) 154
Bsp143I GATC 1 cut(s) 53
Bsp19I CCATGG 1 cut(s) 57
BspACI CCGC 1 cut(s) 185
BspCNI CTCAG 1 cut(s) 85
BspHI TCATGA 1 cut(s) 419
BspLI GGNNCC 1 cut(s) 189
BspPI GGATC 1 cut(s) 48
BspTNI GGTCTC 1 cut(s) 379
BsrGI TGTACA 1 cut(s) 154
BsrI ACTGG 1 cut(s) 216
BssECI CCNNGG 2 cut(s) 57, 191
BssMI GATC 1 cut(s) 53
BssT1I CCWWGG 1 cut(s) 57
BstAUI TGTACA 1 cut(s) 154
BstC8I GCNNGC 1 cut(s) 348
BstDEI CTNAG 1 cut(s) 93
BstDSI CCRYGG 1 cut(s) 57
BstF5I GGATG 2 cut(s) 88, 112
BstKTI GATC 1 cut(s) 56
BstMAI GTCTC 2 cut(s) 40, 379
BstMBI GATC 1 cut(s) 53
BstMWI GCNNNNNNNGC 2 cut(s) 212, 409
BstV1I GCAGC 2 cut(s) 193, 215
BtgI CCRYGG 1 cut(s) 57
BtsCI GGATG 2 cut(s) 88, 112
Cac8I GCNNGC 1 cut(s) 348
CaiI CAGNNNCTG 1 cut(s) 206
CciI TCATGA 1 cut(s) 419
Cfr13I GGNCC 1 cut(s) 263
Csp6I GTAC 2 cut(s) 155, 298
CviAII CATG 4 cut(s) 58, 212, 311, 420
CviJI RGCY 9 cut(s) 32, 151, 188, 206, 260, 308, 350, 403, 412
CviKI_1 RGCY 9 cut(s) 32, 151, 188, 206, 260, 308, 350, 403, 412
CviQI GTAC 2 cut(s) 155, 298
DdeI CTNAG 1 cut(s) 93
DpnI GATC 1 cut(s) 55
DpnII GATC 1 cut(s) 53
DraI TTTAAA 1 cut(s) 382
Eco130I CCWWGG 1 cut(s) 57
Eco31I GGTCTC 1 cut(s) 379
Eco47I GGWCC 1 cut(s) 263
Eco57I CTGAAG 1 cut(s) 258
EcoT14I CCWWGG 1 cut(s) 57
ErhI CCWWGG 1 cut(s) 57
FaeI CATG 4 cut(s) 61, 215, 314, 423
FatI CATG 4 cut(s) 57, 211, 310, 419
FblI GTMKAC 1 cut(s) 331
Fnu4HI GCNGC 3 cut(s) 186, 204, 207
FokI GGATG 2 cut(s) 75, 119
Fsp4HI GCNGC 3 cut(s) 186, 204, 207
GluI GCNGC 3 cut(s) 186, 204, 207
Hin1II CATG 4 cut(s) 61, 215, 314, 423
HincII GTYRAC 2 cut(s) 198, 332
HindII GTYRAC 2 cut(s) 198, 332
HinfI GANTC 2 cut(s) 14, 396
Hpy166II GTNNAC 2 cut(s) 198, 332
Hpy188III TCNNGA 5 cut(s) 11, 92, 227, 266, 420
Hpy8I GTNNAC 2 cut(s) 198, 332
HpyF10VI GCNNNNNNNGC 2 cut(s) 212, 409
HpyF3I CTNAG 1 cut(s) 93
Hsp92II CATG 4 cut(s) 61, 215, 314, 423
Kzo9I GATC 1 cut(s) 53
LmnI GCTCC 1 cut(s) 193
LpnPI CCDG 8 cut(s) 105, 143, 165, 195, 229, 246, 279, 336
Lsp1109I GCAGC 2 cut(s) 193, 215
MalI GATC 1 cut(s) 55
MboI GATC 1 cut(s) 53
MluCI AATT 2 cut(s) 128, 141
MlyI GAGTC 1 cut(s) 405
MnlI CCTC 3 cut(s) 165, 201, 298
MseI TTAA 1 cut(s) 381
MspA1I CMGCKG 1 cut(s) 206
MwoI GCNNNNNNNGC 2 cut(s) 212, 409
NcoI CCATGG 1 cut(s) 57
NdeII GATC 1 cut(s) 53
NlaIII CATG 4 cut(s) 61, 215, 314, 423
NlaIV GGNNCC 1 cut(s) 189
PagI TCATGA 1 cut(s) 419
PfeI GAWTC 1 cut(s) 14
PkrI GCNGC 3 cut(s) 187, 205, 208
PleI GAGTC 1 cut(s) 404
PpsI GAGTC 1 cut(s) 404
PspN4I GGNNCC 1 cut(s) 189
PspPI GGNCC 1 cut(s) 263
PstNI CAGNNNCTG 1 cut(s) 206
PvuII CAGCTG 1 cut(s) 206
RsaI GTAC 2 cut(s) 156, 299
RsaNI GTAC 2 cut(s) 155, 298
SalI GTCGAC 1 cut(s) 330
SaqAI TTAA 1 cut(s) 381
SatI GCNGC 3 cut(s) 186, 204, 207
Sau3AI GATC 1 cut(s) 53
Sau96I GGNCC 1 cut(s) 263
SchI GAGTC 1 cut(s) 405
SetI ASST 5 cut(s) 34, 208, 235, 337, 405
SinI GGWCC 1 cut(s) 263
SmiI ATTTAAAT 1 cut(s) 382
Sse9I AATT 2 cut(s) 128, 141
SsiI CCGC 1 cut(s) 185
StyI CCWWGG 1 cut(s) 57
SwaI ATTTAAAT 1 cut(s) 382
TaqI TCGA 2 cut(s) 52, 331
TasI AATT 2 cut(s) 128, 141
TatI WGTACW 1 cut(s) 154
TauI GCSGC 1 cut(s) 188
TfiI GAWTC 1 cut(s) 14
Tru1I TTAA 1 cut(s) 381
Tru9I TTAA 1 cut(s) 381
TseI GCWGC 2 cut(s) 203, 206
TspDTI ATGAA 1 cut(s) 123
TspGWI ACGGA 1 cut(s) 285
VpaK11BI GGWCC 1 cut(s) 263
XapI RAATTY 1 cut(s) 141
XmiI GTMKAC 1 cut(s) 331
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.