Rmu_sc0001311.1_g000006

Small nuclear ribonucleoprotein SM

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001311.1
Physical Location & Seq
Forward (+)
21886 .. 22243
358 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001311.1_g000006.1.cds

Sequence Viewer

Length: 249 bp
atgaatcggccaatagaggaagatggttccaataatgaggacgaagagttcaatattggaccattttctgtcttgatgatgaatgtcaaaaataacatcagtaagctttttggctgtgtgaagatggtccttgagaatgttgaggagatgtggactgaggtcccaaaaattgccaaggacaagaagaaagtgcaaccagttaacaaagatagattcatcagcaggatgtcctccgttgtgattctgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.46

Weight (kDa)

5.43

Isoelectric Point (pI)

67.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 8
AgsI TTSAA 1 cut(s) 52
AloI GAACNNNNNNTCC 2 cut(s) 32, 64
AluBI AGCT 1 cut(s) 106
AluI AGCT 1 cut(s) 106
AoxI GGCC 1 cut(s) 8
AspS9I GGNCC 3 cut(s) 59, 127, 160
AvaII GGWCC 3 cut(s) 59, 127, 160
BccI CCATC 2 cut(s) 17, 118
Bme18I GGWCC 3 cut(s) 59, 127, 160
BmgT120I GGNCC 3 cut(s) 59, 127, 160
BmiI GGNNCC 2 cut(s) 28, 162
BoxI GACNNNNGTC 1 cut(s) 158
BpuEI CTTGAG 1 cut(s) 152
BsaJI CCNNGG 1 cut(s) 174
Bse1I ACTGG 1 cut(s) 197
BseDI CCNNGG 1 cut(s) 174
BseGI GGATG 1 cut(s) 231
BseMII CTCAG 1 cut(s) 147
BseNI ACTGG 1 cut(s) 197
BseRI GAGGAG 1 cut(s) 158
BshFI GGCC 1 cut(s) 10
BslFI GGGAC 1 cut(s) 146
BsmFI GGGAC 1 cut(s) 146
BsnI GGCC 1 cut(s) 10
BspANI GGCC 1 cut(s) 10
BspCNI CTCAG 1 cut(s) 148
BspLI GGNNCC 2 cut(s) 28, 162
BsrI ACTGG 1 cut(s) 197
BssECI CCNNGG 1 cut(s) 174
BssT1I CCWWGG 1 cut(s) 174
Bst6I CTCTTC 1 cut(s) 39
BstDEI CTNAG 1 cut(s) 156
BstF5I GGATG 1 cut(s) 231
BstPAI GACNNNNGTC 1 cut(s) 158
BsuRI GGCC 1 cut(s) 10
BtsCI GGATG 1 cut(s) 231
Cfr13I GGNCC 3 cut(s) 59, 127, 160
CviJI RGCY 3 cut(s) 10, 106, 114
CviKI_1 RGCY 3 cut(s) 10, 106, 114
DdeI CTNAG 1 cut(s) 156
EaeI YGGCCR 1 cut(s) 8
Eam1104I CTCTTC 1 cut(s) 39
EarI CTCTTC 1 cut(s) 39
Eco130I CCWWGG 1 cut(s) 174
Eco47I GGWCC 3 cut(s) 59, 127, 160
EcoO109I RGGNCCY 1 cut(s) 160
EcoT14I CCWWGG 1 cut(s) 174
ErhI CCWWGG 1 cut(s) 174
FaqI GGGAC 1 cut(s) 146
FokI GGATG 1 cut(s) 238
HaeIII GGCC 1 cut(s) 10
HincII GTYRAC 1 cut(s) 202
HindII GTYRAC 1 cut(s) 202
HindIII AAGCTT 1 cut(s) 104
HinfI GANTC 3 cut(s) 4, 213, 241
HpaI GTTAAC 1 cut(s) 202
Hpy166II GTNNAC 2 cut(s) 153, 202
Hpy188III TCNNGA 1 cut(s) 73
Hpy8I GTNNAC 2 cut(s) 153, 202
HpyCH4V TGCA 1 cut(s) 193
HpyF3I CTNAG 1 cut(s) 156
KspAI GTTAAC 1 cut(s) 202
LpnPI CCDG 2 cut(s) 208, 210
MboII GAAGA 4 cut(s) 32, 56, 133, 196
MluCI AATT 1 cut(s) 168
MnlI CCTC 5 cut(s) 10, 31, 136, 151, 241
MseI TTAA 1 cut(s) 201
NlaIV GGNNCC 2 cut(s) 28, 162
PfeI GAWTC 3 cut(s) 4, 213, 241
PpuMI RGGWCCY 1 cut(s) 160
PshAI GACNNNNGTC 1 cut(s) 158
Psp5II RGGWCCY 1 cut(s) 160
PspN4I GGNNCC 2 cut(s) 28, 162
PspPI GGNCC 3 cut(s) 59, 127, 160
PspPPI RGGWCCY 1 cut(s) 160
SaqAI TTAA 1 cut(s) 201
Sau96I GGNCC 3 cut(s) 59, 127, 160
SetI ASST 2 cut(s) 108, 162
SgeI CNNG 6 cut(s) 85, 143, 187, 193, 209, 235
SinI GGWCC 3 cut(s) 59, 127, 160
SmlI CTYRAG 1 cut(s) 131
SmoI CTYRAG 1 cut(s) 131
Sse9I AATT 1 cut(s) 168
SspI AATATT 1 cut(s) 55
StyI CCWWGG 1 cut(s) 174
TasI AATT 1 cut(s) 168
TfiI GAWTC 3 cut(s) 4, 213, 241
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
TspDTI ATGAA 3 cut(s) 17, 95, 205
TspGWI ACGGA 1 cut(s) 223
VpaK11BI GGWCC 3 cut(s) 59, 127, 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.