Rmu_sc0001516.1_g000064

Small nuclear ribonucleoprotein SM

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001516.1
Physical Location & Seq
Reverse (-)
229633 .. 229935
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001516.1_g000064.1.cds

Sequence Viewer

Length: 303 bp
atgagtcggctaatagaggaagatggttccaagaatgaggaagaggagtttaatattggaccactttctgttctgatgatgagtgccaaaaataacacccaggtcctcatcaattgtcgtaataataggaagctttttggctgtgtgaagatggtccttgagaatgttaaggagatgtggaccgaggtcccaaaaactggcaagggcaagaagaaagtgcaactggttaacaaagatagattcatcagcatgatgttcctccgtggtgattatgtgattattgttcttacgaatcctaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.54

Weight (kDa)

9.39

Isoelectric Point (pI)

41.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 197
AfiI CCNNNNNNNGG 1 cut(s) 197
AjnI CCWGG 1 cut(s) 99
AluBI AGCT 1 cut(s) 133
AluI AGCT 1 cut(s) 133
AspS9I GGNCC 5 cut(s) 59, 103, 154, 180, 187
AsuHPI GGTGA 1 cut(s) 278
AvaII GGWCC 5 cut(s) 59, 103, 154, 180, 187
BccI CCATC 2 cut(s) 17, 145
BciT130I CCWGG 1 cut(s) 101
Bme1390I CCNGG 1 cut(s) 101
Bme18I GGWCC 5 cut(s) 59, 103, 154, 180, 187
BmgT120I GGNCC 5 cut(s) 59, 103, 154, 180, 187
BmiI GGNNCC 2 cut(s) 28, 189
BmrFI CCNGG 1 cut(s) 101
BoxI GACNNNNGTC 1 cut(s) 185
BpuEI CTTGAG 1 cut(s) 179
BsaJI CCNNGG 3 cut(s) 99, 183, 262
Bsc4I CCNNNNNNNGG 1 cut(s) 197
Bse1I ACTGG 2 cut(s) 202, 228
BseBI CCWGG 1 cut(s) 101
BseDI CCNNGG 3 cut(s) 99, 183, 262
BseLI CCNNNNNNNGG 1 cut(s) 197
BseNI ACTGG 2 cut(s) 202, 228
BseRI GAGGAG 1 cut(s) 59
BslFI GGGAC 1 cut(s) 173
BslI CCNNNNNNNGG 1 cut(s) 197
BsmFI GGGAC 1 cut(s) 173
BspLI GGNNCC 2 cut(s) 28, 189
BsrI ACTGG 2 cut(s) 202, 228
BssECI CCNNGG 3 cut(s) 99, 183, 262
Bst2UI CCWGG 1 cut(s) 101
Bst6I CTCTTC 1 cut(s) 36
BstDEI CTNAG 1 cut(s) 297
BstDSI CCRYGG 1 cut(s) 262
BstNI CCWGG 1 cut(s) 101
BstPAI GACNNNNGTC 1 cut(s) 185
BstSCI CCNGG 1 cut(s) 99
BtgI CCRYGG 1 cut(s) 262
Cfr13I GGNCC 5 cut(s) 59, 103, 154, 180, 187
CviAII CATG 1 cut(s) 250
CviJI RGCY 3 cut(s) 10, 133, 141
CviKI_1 RGCY 3 cut(s) 10, 133, 141
DdeI CTNAG 1 cut(s) 297
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
Eco47I GGWCC 5 cut(s) 59, 103, 154, 180, 187
EcoO109I RGGNCCY 2 cut(s) 103, 187
EcoRII CCWGG 1 cut(s) 99
FaeI CATG 1 cut(s) 253
FaiI YATR 2 cut(s) 251, 273
FaqI GGGAC 1 cut(s) 173
FatI CATG 1 cut(s) 249
Hin1II CATG 1 cut(s) 253
HincII GTYRAC 1 cut(s) 229
HindII GTYRAC 1 cut(s) 229
HindIII AAGCTT 1 cut(s) 131
HinfI GANTC 3 cut(s) 4, 240, 292
HpaI GTTAAC 1 cut(s) 229
HphI GGTGA 1 cut(s) 278
Hpy166II GTNNAC 2 cut(s) 180, 229
Hpy188I TCNGA 1 cut(s) 75
Hpy8I GTNNAC 2 cut(s) 180, 229
HpyCH4V TGCA 1 cut(s) 220
HpyF3I CTNAG 1 cut(s) 297
Hsp92II CATG 1 cut(s) 253
KspAI GTTAAC 1 cut(s) 229
LpnPI CCDG 4 cut(s) 86, 113, 183, 209
MboII GAAGA 4 cut(s) 32, 53, 160, 223
MfeI CAATTG 1 cut(s) 112
MluCI AATT 1 cut(s) 112
MlyI GAGTC 1 cut(s) 13
MnlI CCTC 6 cut(s) 10, 31, 37, 116, 178, 269
MseI TTAA 3 cut(s) 51, 168, 228
MslI CAYNNNNRTG 1 cut(s) 248
MspR9I CCNGG 1 cut(s) 101
MunI CAATTG 1 cut(s) 112
MvaI CCWGG 1 cut(s) 101
NlaIII CATG 1 cut(s) 253
NlaIV GGNNCC 2 cut(s) 28, 189
PfeI GAWTC 2 cut(s) 240, 292
PflMI CCANNNNNTGG 1 cut(s) 197
PleI GAGTC 1 cut(s) 12
PpsI GAGTC 1 cut(s) 12
PpuMI RGGWCCY 2 cut(s) 103, 187
PshAI GACNNNNGTC 1 cut(s) 185
Psp5II RGGWCCY 2 cut(s) 103, 187
Psp6I CCWGG 1 cut(s) 99
PspGI CCWGG 1 cut(s) 99
PspN4I GGNNCC 2 cut(s) 28, 189
PspPI GGNCC 5 cut(s) 59, 103, 154, 180, 187
PspPPI RGGWCCY 2 cut(s) 103, 187
RseI CAYNNNNRTG 1 cut(s) 248
SaqAI TTAA 3 cut(s) 51, 168, 228
Sau96I GGNCC 5 cut(s) 59, 103, 154, 180, 187
SchI GAGTC 1 cut(s) 13
ScrFI CCNGG 1 cut(s) 101
SetI ASST 3 cut(s) 105, 135, 189
SinI GGWCC 5 cut(s) 59, 103, 154, 180, 187
SmiMI CAYNNNNRTG 1 cut(s) 248
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
Sse9I AATT 1 cut(s) 112
SspI AATATT 1 cut(s) 55
StyD4I CCNGG 1 cut(s) 99
TaqII GACCGA 1 cut(s) 197
TasI AATT 1 cut(s) 112
TfiI GAWTC 2 cut(s) 240, 292
Tru1I TTAA 3 cut(s) 51, 168, 228
Tru9I TTAA 3 cut(s) 51, 168, 228
TspDTI ATGAA 1 cut(s) 232
TspGWI ACGGA 1 cut(s) 251
Van91I CCANNNNNTGG 1 cut(s) 197
VpaK11BI GGWCC 5 cut(s) 59, 103, 154, 180, 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.