Rroxscaffold_3G00253420

Small nuclear ribonucleoprotein SM

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
47435088 .. 47435472
385 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00253420.1

Sequence Viewer

Length: 252 bp
ATGAGTCGGCCAATAGAGGAAGATGGTTCCAATAATGAGGACGAAGAGTTCAATATTGGACCATTTTCTGTCTTGATGATGATAACATTGCTCAAAAATAACACCCAGGTCCTCAACAATTGTCGTAATAACAGTAAGCTTTTTGGCTGTGTGAAGATGGTCCTTGAGAATGTTGAGGAGATGTGGACTGAGGTCCCAAAAGATGTCCTCCGTTGTGATTCTGTGATTATAATTCTTAGGAATCCTAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.56

Weight (kDa)

4.71

Isoelectric Point (pI)

63.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 230
AcoI YGGCCR 1 cut(s) 8
AgsI TTSAA 1 cut(s) 52
AjnI CCWGG 1 cut(s) 105
AloI GAACNNNNNNTCC 2 cut(s) 32, 64
AluBI AGCT 1 cut(s) 139
AluI AGCT 1 cut(s) 139
AoxI GGCC 1 cut(s) 8
AspS9I GGNCC 4 cut(s) 59, 109, 160, 193
AvaII GGWCC 4 cut(s) 59, 109, 160, 193
BccI CCATC 2 cut(s) 17, 151
BciT130I CCWGG 1 cut(s) 107
Bme1390I CCNGG 1 cut(s) 107
Bme18I GGWCC 4 cut(s) 59, 109, 160, 193
BmgT120I GGNCC 4 cut(s) 59, 109, 160, 193
BmiI GGNNCC 2 cut(s) 28, 195
BmrFI CCNGG 1 cut(s) 107
BoxI GACNNNNGTC 1 cut(s) 191
BpuEI CTTGAG 1 cut(s) 185
BsaJI CCNNGG 1 cut(s) 105
Bse3DI GCAATG 1 cut(s) 86
BseBI CCWGG 1 cut(s) 107
BseDI CCNNGG 1 cut(s) 105
BseMI GCAATG 1 cut(s) 86
BseMII CTCAG 1 cut(s) 180
BseRI GAGGAG 1 cut(s) 191
BshFI GGCC 1 cut(s) 10
BslFI GGGAC 1 cut(s) 179
BsmFI GGGAC 1 cut(s) 179
BsnI GGCC 1 cut(s) 10
BspANI GGCC 1 cut(s) 10
BspCNI CTCAG 1 cut(s) 181
BspLI GGNNCC 2 cut(s) 28, 195
BsrDI GCAATG 1 cut(s) 86
BssECI CCNNGG 1 cut(s) 105
Bst2UI CCWGG 1 cut(s) 107
Bst4CI ACNGT 1 cut(s) 134
Bst6I CTCTTC 1 cut(s) 39
BstDEI CTNAG 3 cut(s) 189, 236, 246
BstNI CCWGG 1 cut(s) 107
BstPAI GACNNNNGTC 1 cut(s) 191
BstSCI CCNGG 1 cut(s) 105
BsuRI GGCC 1 cut(s) 10
Cfr13I GGNCC 4 cut(s) 59, 109, 160, 193
CviJI RGCY 3 cut(s) 10, 139, 147
CviKI_1 RGCY 3 cut(s) 10, 139, 147
DdeI CTNAG 3 cut(s) 189, 236, 246
EaeI YGGCCR 1 cut(s) 8
Eam1104I CTCTTC 1 cut(s) 39
EarI CTCTTC 1 cut(s) 39
Eco47I GGWCC 4 cut(s) 59, 109, 160, 193
EcoO109I RGGNCCY 2 cut(s) 109, 193
EcoRII CCWGG 1 cut(s) 105
FaiI YATR 1 cut(s) 230
FaqI GGGAC 1 cut(s) 179
HaeIII GGCC 1 cut(s) 10
HindIII AAGCTT 1 cut(s) 137
HinfI GANTC 3 cut(s) 4, 218, 241
Hpy166II GTNNAC 1 cut(s) 186
Hpy188III TCNNGA 1 cut(s) 73
Hpy8I GTNNAC 1 cut(s) 186
HpyCH4III ACNGT 1 cut(s) 134
HpyF3I CTNAG 3 cut(s) 189, 236, 246
LpnPI CCDG 2 cut(s) 92, 119
MboII GAAGA 3 cut(s) 32, 56, 166
MfeI CAATTG 1 cut(s) 118
MluCI AATT 2 cut(s) 118, 231
MlyI GAGTC 1 cut(s) 13
MnlI CCTC 6 cut(s) 10, 31, 122, 169, 184, 218
MspR9I CCNGG 1 cut(s) 107
MunI CAATTG 1 cut(s) 118
MvaI CCWGG 1 cut(s) 107
NlaIV GGNNCC 2 cut(s) 28, 195
PfeI GAWTC 2 cut(s) 218, 241
PleI GAGTC 1 cut(s) 12
PpsI GAGTC 1 cut(s) 12
PpuMI RGGWCCY 2 cut(s) 109, 193
PshAI GACNNNNGTC 1 cut(s) 191
PsiI TTATAA 1 cut(s) 230
Psp5II RGGWCCY 2 cut(s) 109, 193
Psp6I CCWGG 1 cut(s) 105
PspGI CCWGG 1 cut(s) 105
PspN4I GGNNCC 2 cut(s) 28, 195
PspPI GGNCC 4 cut(s) 59, 109, 160, 193
PspPPI RGGWCCY 2 cut(s) 109, 193
Sau96I GGNCC 4 cut(s) 59, 109, 160, 193
SchI GAGTC 1 cut(s) 13
ScrFI CCNGG 1 cut(s) 107
SetI ASST 3 cut(s) 111, 141, 195
SgeI CNNG 4 cut(s) 85, 118, 119, 176
SinI GGWCC 4 cut(s) 59, 109, 160, 193
SmlI CTYRAG 1 cut(s) 164
SmoI CTYRAG 1 cut(s) 164
Sse9I AATT 2 cut(s) 118, 231
SspI AATATT 1 cut(s) 55
StyD4I CCNGG 1 cut(s) 105
TaaI ACNGT 1 cut(s) 134
TasI AATT 2 cut(s) 118, 231
TfiI GAWTC 2 cut(s) 218, 241
TspGWI ACGGA 1 cut(s) 200
VpaK11BI GGWCC 4 cut(s) 59, 109, 160, 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.