Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001350.1

Orthogroup ID

OG0009678

Physical Location & Seq

Genomic Coordinates Reverse (-)

78402 .. 78746

Gene Structure 345 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001350.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 345 bp

atgtggttaaaagatggagacagaaactcagcttttttgcatcataaagcctctaacagaaaatgtcacaataccattcagggttacagaatgcacaaggggagtggtcttcgaatcctgatgcagtggatacttctgaaatactacaacaatatttttgctactgaaaatacagatgaagaggccatttcagagattttcagagcaaccccattgaaagtcacaccaactatgaacatggacttgctgcagccttatcctgatgaggaaatcaaggctactttgtttcagatgcacccttcaaagagccctagacctgatgttatgtctcctttcttttcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_2 PfkB TB2_DP1_HVA22

Protein Analysis

114

Amino Acids

13.33

Weight (kDa)

8.76

Isoelectric Point (pI)

63.47

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009678)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g10222
pyrus_communis	pycom05g03820 pycom13g14160
rosa_chinensis	RchiOBHm_Chr3g0481911 RchiOBHm_Chr7g0230761
rosa_multiflora	Rmu_co8504529.1_g000002 Rmu_sc0001350.1_g000011 Rmu_sc0001847.1_g000004 Rmu_sc0006323.1_g000012 Rmu_sc0007994.1_g000004 Rmu_sc0010800.1_g000001 Rmu_sc0013801.1_g000003 Rmu_sc0018646.1_g000004 Rmu_sc0024195.1_g000003 Rmu_sc0037386.1_g000001 Rmu_sc0040395.1_g000001
rosa_roxburghii	Rroxscaffold_3G00233950 Rroxscaffold_3G00238590 Rroxscaffold_5G00334460 Rroxscaffold_7G00177700 Rroxscaffold_7G00178180
rosa_rugosa	Rorug07G0126600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	2 cut(s)	217, 303
AluBI	AGCT	1 cut(s)	32
AluI	AGCT	1 cut(s)	32
Alw26I	GTCTC	2 cut(s)	12, 333
AoxI	GGCC	1 cut(s)	183
ApeKI	GCWGC	2 cut(s)	247, 250
AsuII	TTCGAA	1 cut(s)	112
BanII	GRGCYC	1 cut(s)	311
BbsI	GAAGAC	1 cut(s)	101
BbvI	GCAGC	2 cut(s)	234, 262
BccI	CCATC	1 cut(s)	8
BciVI	GTATCC	1 cut(s)	123
BcoDI	GTCTC	2 cut(s)	12, 333
BfaI	CTAG	1 cut(s)	312
BfmI	CTRYAG	1 cut(s)	248
BfuI	GTATCC	1 cut(s)	123
BisI	GCNGC	2 cut(s)	248, 251
BlsI	GCNGC	2 cut(s)	249, 252
BmsI	GCATC	3 cut(s)	49, 111, 282
BpiI	GAAGAC	1 cut(s)	101
Bpu14I	TTCGAA	1 cut(s)	112
BseMII	CTCAG	1 cut(s)	42
BseXI	GCAGC	2 cut(s)	234, 262
BshFI	GGCC	1 cut(s)	185
BsmAI	GTCTC	2 cut(s)	12, 333
BsmI	GAATGC	1 cut(s)	96
BsnI	GGCC	1 cut(s)	185
Bsp119I	TTCGAA	1 cut(s)	112
Bsp1286I	GDGCHC	1 cut(s)	311
BspANI	GGCC	1 cut(s)	185
BspCNI	CTCAG	1 cut(s)	41
BspMAI	CTGCAG	1 cut(s)	252
BspT104I	TTCGAA	1 cut(s)	112
Bst6I	CTCTTC	1 cut(s)	174
BstBI	TTCGAA	1 cut(s)	112
BstDEI	CTNAG	2 cut(s)	28, 342
BstMAI	GTCTC	2 cut(s)	12, 333
BstSFI	CTRYAG	1 cut(s)	248
BstV1I	GCAGC	2 cut(s)	234, 262
BstV2I	GAAGAC	1 cut(s)	101
BsuI	GTATCC	1 cut(s)	123
BsuRI	GGCC	1 cut(s)	185
BtsI	GCAGTG	1 cut(s)	131
BtsIMutI	CAGTG	1 cut(s)	131
CspCI	CAANNNNNGTGG	2 cut(s)	85, 120
CviAII	CATG	1 cut(s)	238
CviJI	RGCY	6 cut(s)	32, 50, 185, 253, 278, 309
CviKI_1	RGCY	6 cut(s)	32, 50, 185, 253, 278, 309
DdeI	CTNAG	2 cut(s)	28, 342
Eam1104I	CTCTTC	1 cut(s)	174
EarI	CTCTTC	1 cut(s)	174
Eco24I	GRGCYC	1 cut(s)	311
EcoT38I	GRGCYC	1 cut(s)	311
FaeI	CATG	1 cut(s)	241
FaiI	YATR	4 cut(s)	45, 233, 239, 326
FatI	CATG	1 cut(s)	237
Fnu4HI	GCNGC	2 cut(s)	248, 251
FriOI	GRGCYC	1 cut(s)	311
Fsp4HI	GCNGC	2 cut(s)	248, 251
FspBI	CTAG	1 cut(s)	312
GluI	GCNGC	2 cut(s)	248, 251
HaeIII	GGCC	1 cut(s)	185
Hin1II	CATG	1 cut(s)	241
HinfI	GANTC	1 cut(s)	114
Hpy188I	TCNGA	4 cut(s)	138, 193, 203, 291
Hpy188III	TCNNGA	2 cut(s)	118, 260
HpyAV	CCTTC	1 cut(s)	309
HpyCH4V	TGCA	5 cut(s)	40, 94, 124, 250, 295
HpyF3I	CTNAG	2 cut(s)	28, 342
Hsp92II	CATG	1 cut(s)	241
LpnPI	CCDG	4 cut(s)	65, 131, 273, 330
Lsp1109I	GCAGC	2 cut(s)	234, 262
LweI	GCATC	3 cut(s)	49, 111, 282
MaeI	CTAG	1 cut(s)	312
MaeIII	GTNAC	3 cut(s)	65, 83, 220
MboII	GAAGA	2 cut(s)	101, 191
MhlI	GDGCHC	1 cut(s)	311
MnlI	CCTC	3 cut(s)	61, 175, 259
MseI	TTAA	1 cut(s)	8
Mva1269I	GAATGC	1 cut(s)	96
NlaIII	CATG	1 cut(s)	241
NmuCI	GTSAC	2 cut(s)	65, 220
NspV	TTCGAA	1 cut(s)	112
PctI	GAATGC	1 cut(s)	96
PfeI	GAWTC	1 cut(s)	114
PkrI	GCNGC	2 cut(s)	249, 252
PstI	CTGCAG	1 cut(s)	252
SaqAI	TTAA	1 cut(s)	8
SatI	GCNGC	2 cut(s)	248, 251
SduI	GDGCHC	1 cut(s)	311
SetI	ASST	2 cut(s)	34, 319
SfaNI	GCATC	3 cut(s)	49, 111, 282
SfcI	CTRYAG	1 cut(s)	248
SfuI	TTCGAA	1 cut(s)	112
SgeI	CNNG	9 cut(s)	92, 109, 130, 250, 256, 272, 286, 324, 329
SspI	AATATT	1 cut(s)	154
SspMI	CTAG	1 cut(s)	312
TaqI	TCGA	1 cut(s)	112
TfiI	GAWTC	1 cut(s)	114
Tru1I	TTAA	1 cut(s)	8
Tru9I	TTAA	1 cut(s)	8
TscAI	CASTG	1 cut(s)	131
TseFI	GTSAC	2 cut(s)	65, 220
TseI	GCWGC	2 cut(s)	247, 250
Tsp45I	GTSAC	2 cut(s)	65, 220
TspDTI	ATGAA	2 cut(s)	192, 248
TspRI	CASTG	1 cut(s)	131
XspI	CTAG	1 cut(s)	312

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.