Rmu_sc0040395.1_g000001

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040395.1
OG0009678
Physical Location & Seq
Forward (+)
233 .. 520
288 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040395.1_g000001.1.cds

Sequence Viewer

Length: 288 bp
atgatcaaagggatacaggatgaggccggagtttggcatgttgaaccagctaaagttaaagatttgttaatgcagcactttacgtccatctttactacagaagggacggacccggaggctatgttagatgtcctgagtgctattccgactagggttacaacaaatatgaatgatgagttgctcaaaccttacactgatgaggaaataaaggaggcgttgtttcaaatgcatccctcaaaaagcccgaggccagatgggatgtcgttgttctttttccagaagtactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2 PfkB TB2_DP1_HVA22

Protein Analysis

95

Amino Acids

10.88

Weight (kDa)

4.86

Isoelectric Point (pI)

32.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 284
AfiI CCNNNNNNNGG 1 cut(s) 33
AgsI TTSAA 2 cut(s) 44, 224
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
Ama87I CYCGRG 1 cut(s) 244
AoxI GGCC 2 cut(s) 24, 248
ApeKI GCWGC 1 cut(s) 73
AspS9I GGNCC 1 cut(s) 109
AsuC2I CCSGG 1 cut(s) 113
AvaI CYCGRG 1 cut(s) 244
AvaII GGWCC 1 cut(s) 109
BbvI GCAGC 1 cut(s) 85
BccI CCATC 2 cut(s) 95, 248
BciVI GTATCC 1 cut(s) 6
BclI TGATCA 1 cut(s) 3
BcnI CCSGG 1 cut(s) 113
BfaI CTAG 2 cut(s) 150, 286
BfmI CTRYAG 1 cut(s) 96
BfuI GTATCC 1 cut(s) 6
BisI GCNGC 1 cut(s) 74
BlsI GCNGC 1 cut(s) 75
BmcAI AGTACT 1 cut(s) 284
Bme1390I CCNGG 1 cut(s) 113
Bme18I GGWCC 1 cut(s) 109
BmeT110I CYCGRG 1 cut(s) 244
BmgT120I GGNCC 1 cut(s) 109
BmiI GGNNCC 1 cut(s) 111
BmrFI CCNGG 1 cut(s) 113
BmsI GCATC 1 cut(s) 238
BpuMI CCSGG 1 cut(s) 113
BsaJI CCNNGG 1 cut(s) 245
BsaXI ACNNNNNCTCC 4 cut(s) 107, 137, 203, 233
Bsc4I CCNNNNNNNGG 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 245
BseGI GGATG 3 cut(s) 25, 229, 264
BseLI CCNNNNNNNGG 1 cut(s) 33
BseMII CTCAG 1 cut(s) 125
BseXI GCAGC 1 cut(s) 85
BshFI GGCC 2 cut(s) 26, 250
BsiHKCI CYCGRG 1 cut(s) 244
BsiSI CCGG 2 cut(s) 27, 113
BslFI GGGAC 1 cut(s) 118
BslI CCNNNNNNNGG 1 cut(s) 33
BsmFI GGGAC 1 cut(s) 118
BsnI GGCC 2 cut(s) 26, 250
BsoBI CYCGRG 1 cut(s) 244
Bsp143I GATC 1 cut(s) 3
BspANI GGCC 2 cut(s) 26, 250
BspCNI CTCAG 1 cut(s) 126
BspLI GGNNCC 1 cut(s) 111
BssECI CCNNGG 1 cut(s) 245
BssMI GATC 1 cut(s) 3
BstDEI CTNAG 1 cut(s) 134
BstF5I GGATG 3 cut(s) 25, 229, 264
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstNSI RCATGY 1 cut(s) 41
BstSCI CCNGG 1 cut(s) 111
BstSFI CTRYAG 1 cut(s) 96
BstV1I GCAGC 1 cut(s) 85
BsuI GTATCC 1 cut(s) 6
BsuRI GGCC 2 cut(s) 26, 250
BtsCI GGATG 3 cut(s) 25, 229, 264
BtsIMutI CAGTG 1 cut(s) 192
Cfr13I GGNCC 1 cut(s) 109
Csp6I GTAC 1 cut(s) 283
CviAII CATG 1 cut(s) 38
CviJI RGCY 5 cut(s) 26, 50, 119, 243, 250
CviKI_1 RGCY 5 cut(s) 26, 50, 119, 243, 250
CviQI GTAC 1 cut(s) 283
DdeI CTNAG 1 cut(s) 134
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eco47I GGWCC 1 cut(s) 109
Eco88I CYCGRG 1 cut(s) 244
EcoT22I ATGCAT 1 cut(s) 231
FaeI CATG 1 cut(s) 41
FaiI YATR 3 cut(s) 39, 122, 167
FaqI GGGAC 1 cut(s) 118
FatI CATG 1 cut(s) 37
FbaI TGATCA 1 cut(s) 3
Fnu4HI GCNGC 1 cut(s) 74
FokI GGATG 3 cut(s) 32, 216, 271
Fsp4HI GCNGC 1 cut(s) 74
FspBI CTAG 2 cut(s) 150, 286
GluI GCNGC 1 cut(s) 74
HaeIII GGCC 2 cut(s) 26, 250
HapII CCGG 2 cut(s) 27, 113
Hin1II CATG 1 cut(s) 41
HpaII CCGG 2 cut(s) 27, 113
Hpy188I TCNGA 1 cut(s) 147
Hpy188III TCNNGA 2 cut(s) 133, 277
HpyAV CCTTC 1 cut(s) 95
HpyCH4IV ACGT 1 cut(s) 83
HpyCH4V TGCA 2 cut(s) 73, 229
HpyF3I CTNAG 1 cut(s) 134
HpySE526I ACGT 1 cut(s) 83
Hsp92II CATG 1 cut(s) 41
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 6 cut(s) 2, 40, 60, 126, 146, 264
Lsp1109I GCAGC 1 cut(s) 85
LweI GCATC 1 cut(s) 238
MaeI CTAG 2 cut(s) 150, 286
MaeII ACGT 1 cut(s) 83
MaeIII GTNAC 1 cut(s) 154
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MmeI TCCRAC 1 cut(s) 170
MnlI CCTC 6 cut(s) 16, 109, 193, 205, 240, 244
Mph1103I ATGCAT 1 cut(s) 231
MseI TTAA 2 cut(s) 57, 68
MspI CCGG 2 cut(s) 27, 113
MspR9I CCNGG 1 cut(s) 113
NciI CCSGG 1 cut(s) 113
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 41
NlaIV GGNNCC 1 cut(s) 111
NsiI ATGCAT 1 cut(s) 231
NspI RCATGY 1 cut(s) 41
PkrI GCNGC 1 cut(s) 75
PspN4I GGNNCC 1 cut(s) 111
PspPI GGNCC 1 cut(s) 109
RsaI GTAC 1 cut(s) 284
RsaNI GTAC 1 cut(s) 283
SaqAI TTAA 2 cut(s) 57, 68
SatI GCNGC 1 cut(s) 74
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 1 cut(s) 109
ScaI AGTACT 1 cut(s) 284
ScrFI CCNGG 1 cut(s) 113
SetI ASST 3 cut(s) 52, 86, 190
SfaNI GCATC 1 cut(s) 238
SfcI CTRYAG 1 cut(s) 96
SinI GGWCC 1 cut(s) 109
SspMI CTAG 2 cut(s) 150, 286
StyD4I CCNGG 1 cut(s) 111
TaiI ACGT 1 cut(s) 86
TatI WGTACW 1 cut(s) 282
Tru1I TTAA 2 cut(s) 57, 68
Tru9I TTAA 2 cut(s) 57, 68
TscAI CASTG 1 cut(s) 199
TseI GCWGC 1 cut(s) 73
TspDTI ATGAA 1 cut(s) 182
TspGWI ACGGA 1 cut(s) 122
TspRI CASTG 1 cut(s) 199
VpaK11BI GGWCC 1 cut(s) 109
XceI RCATGY 1 cut(s) 41
XspI CTAG 2 cut(s) 150, 286
ZrmI AGTACT 1 cut(s) 284
Zsp2I ATGCAT 1 cut(s) 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.