Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001847.1

Orthogroup ID

OG0009678

Physical Location & Seq

Genomic Coordinates Reverse (-)

11500 .. 14925

Gene Structure 3426 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001847.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 858 bp

atgagatgccatgctgacaagtcagggggtcctcttagacttttagcccaaatgcgcagatttagacaagcccttggcgactgtgattttatcaacatggggttaatcctgaactggccatatcgaatcaaaatcctaagcaatttcgttttgaggagatgtggcaggttggcttatgttgaatgtgctaatgtagtggaacaagcacttgatgtggtgttggattgcttacaacccaaggtatcagaggagatgaactatgagcttacagctccgtactctgatgctgaaatcaaaaaggctttatttcaaatgtatgcctcaaagtcgctgggtcttgatgggatgtccccttgcttcttccagaaattttggaatgtggtggaatgtgatgtatgctgtgcagttagggaagtgttgaaaggtctttcagccttgatttcctcctctatccataaaggaactattggaggcttaaccatggcccctactgctcccactatccgccatctactttttgcagatgatagctttctctttggggaagcctcaaaacctagtgtggtgtttagcggtaatgtcagtttgcagaacaagaacaacctagcagctattcttggggtgcagtgtgttaaagaaaatggtttatatcttggtttgcctattcagtatggtggtaaggggggtgtgataagaaactctcaaggtcagttcattgctggcttttcttatagaatggagtttgtcagctccccattgcacatcgaactactagccttgaagaatggattggaactgctccaggctatgcaaatcacacgagctgttgtggagagcgactgcttacttgcagtgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Exo_endo_phos_2 RVT_1

Protein Analysis

285

Amino Acids

31.36

Weight (kDa)

8.26

Isoelectric Point (pI)

43.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009678)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g10222
pyrus_communis	pycom05g03820 pycom13g14160
rosa_chinensis	RchiOBHm_Chr3g0481911 RchiOBHm_Chr7g0230761
rosa_multiflora	Rmu_co8504529.1_g000002 Rmu_sc0001350.1_g000011 Rmu_sc0001847.1_g000004 Rmu_sc0006323.1_g000012 Rmu_sc0007994.1_g000004 Rmu_sc0010800.1_g000001 Rmu_sc0013801.1_g000003 Rmu_sc0018646.1_g000004 Rmu_sc0024195.1_g000003 Rmu_sc0037386.1_g000001 Rmu_sc0040395.1_g000001
rosa_roxburghii	Rroxscaffold_3G00233950 Rroxscaffold_3G00238590 Rroxscaffold_5G00334460 Rroxscaffold_7G00177700 Rroxscaffold_7G00178180
rosa_rugosa	Rorug07G0126600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	56
Acc36I	ACCTGC	1 cut(s)	156
AciI	CCGC	2 cut(s)	505, 573
AcoI	YGGCCR	1 cut(s)	116
AcsI	RAATTY	1 cut(s)	368
AfaI	GTAC	1 cut(s)	278
AgsI	TTSAA	4 cut(s)	182, 311, 421, 781
AjnI	CCWGG	1 cut(s)	801
AjuI	GAANNNNNNNTTGG	2 cut(s)	773, 805
AluBI	AGCT	6 cut(s)	265, 272, 531, 611, 750, 824
AluI	AGCT	6 cut(s)	265, 272, 531, 611, 750, 824
AoxI	GGCC	2 cut(s)	116, 483
ApeKI	GCWGC	1 cut(s)	608
ApoI	RAATTY	1 cut(s)	368
AspLEI	GCGC	1 cut(s)	57
AspS9I	GGNCC	2 cut(s)	29, 484
AvaII	GGWCC	1 cut(s)	29
BalI	TGGCCA	1 cut(s)	118
BauI	CACGAG	1 cut(s)	819
BbvI	GCAGC	1 cut(s)	620
BccI	CCATC	2 cut(s)	335, 516
BciT130I	CCWGG	1 cut(s)	803
BfaI	CTAG	3 cut(s)	558, 605, 773
BfuAI	ACCTGC	1 cut(s)	156
BisI	GCNGC	1 cut(s)	609
BlsI	GCNGC	1 cut(s)	610
Bme1390I	CCNGG	1 cut(s)	803
Bme18I	GGWCC	1 cut(s)	29
BmgT120I	GGNCC	2 cut(s)	29, 484
BmiI	GGNNCC	2 cut(s)	30, 486
BmrFI	CCNGG	1 cut(s)	803
BmsI	GCATC	1 cut(s)	274
BpmI	CTGGAG	1 cut(s)	785
Bpu10I	CCTNAGC	1 cut(s)	137
BpuEI	CTTGAG	1 cut(s)	687
BsaJI	CCNNGG	3 cut(s)	73, 237, 480
Bse1I	ACTGG	1 cut(s)	119
Bse3DI	GCAATG	2 cut(s)	714, 755
BseBI	CCWGG	1 cut(s)	803
BseDI	CCNNGG	3 cut(s)	73, 237, 480
BseGI	GGATG	1 cut(s)	351
BseMI	GCAATG	2 cut(s)	714, 755
BseNI	ACTGG	1 cut(s)	119
BseRI	GAGGAG	3 cut(s)	169, 263, 436
BseXI	GCAGC	1 cut(s)	620
BseYI	CCCAGC	1 cut(s)	331
BsgI	GTGCAG	2 cut(s)	423, 644
BshFI	GGCC	2 cut(s)	118, 485
BslFI	GGGAC	1 cut(s)	334
BsmFI	GGGAC	1 cut(s)	334
BsnI	GGCC	2 cut(s)	118, 485
Bsp19I	CCATGG	1 cut(s)	480
BspACI	CCGC	2 cut(s)	505, 573
BspANI	GGCC	2 cut(s)	118, 485
BspLI	GGNNCC	2 cut(s)	30, 486
BspMI	ACCTGC	1 cut(s)	156
BsrDI	GCAATG	2 cut(s)	714, 755
BsrI	ACTGG	1 cut(s)	119
BssECI	CCNNGG	3 cut(s)	73, 237, 480
BssSI	CACGAG	1 cut(s)	819
BssT1I	CCWWGG	3 cut(s)	73, 237, 480
Bst2BI	CACGAG	1 cut(s)	819
Bst2UI	CCWGG	1 cut(s)	803
Bst4CI	ACNGT	1 cut(s)	83
BstC8I	GCNNGC	1 cut(s)	721
BstDEI	CTNAG	2 cut(s)	35, 137
BstDSI	CCRYGG	1 cut(s)	480
BstF5I	GGATG	1 cut(s)	351
BstHHI	GCGC	1 cut(s)	57
BstMWI	GCNNNNNNNGC	1 cut(s)	491
BstNI	CCWGG	1 cut(s)	803
BstSCI	CCNGG	1 cut(s)	801
BstV1I	GCAGC	1 cut(s)	620
BsuRI	GGCC	2 cut(s)	118, 485
BtgI	CCRYGG	1 cut(s)	480
BtsCI	GGATG	1 cut(s)	351
BtsI	GCAGTG	2 cut(s)	632, 858
BtsIMutI	CAGTG	2 cut(s)	632, 858
BveI	ACCTGC	1 cut(s)	156
Cac8I	GCNNGC	1 cut(s)	721
CfoI	GCGC	1 cut(s)	57
Cfr13I	GGNCC	2 cut(s)	29, 484
Csp6I	GTAC	1 cut(s)	277
CviAII	CATG	3 cut(s)	11, 97, 481
CviQI	GTAC	1 cut(s)	277
DdeI	CTNAG	2 cut(s)	35, 137
EaeI	YGGCCR	1 cut(s)	116
EciI	GGCGGA	1 cut(s)	494
Eco130I	CCWWGG	3 cut(s)	73, 237, 480
Eco47I	GGWCC	1 cut(s)	29
EcoO109I	RGGNCCY	1 cut(s)	29
EcoRII	CCWGG	1 cut(s)	801
EcoT14I	CCWWGG	3 cut(s)	73, 237, 480
ErhI	CCWWGG	3 cut(s)	73, 237, 480
FaeI	CATG	3 cut(s)	14, 100, 484
FaqI	GGGAC	1 cut(s)	334
FatI	CATG	3 cut(s)	10, 96, 480
Fnu4HI	GCNGC	1 cut(s)	609
FokI	GGATG	1 cut(s)	358
Fsp4HI	GCNGC	1 cut(s)	609
FspBI	CTAG	3 cut(s)	558, 605, 773
FspI	TGCGCA	1 cut(s)	56
GlaI	GCGC	1 cut(s)	56
GluI	GCNGC	1 cut(s)	609
GsaI	CCCAGC	1 cut(s)	335
GsuI	CTGGAG	1 cut(s)	785
HaeIII	GGCC	2 cut(s)	118, 485
HhaI	GCGC	1 cut(s)	57
Hin1II	CATG	3 cut(s)	14, 100, 484
Hin6I	GCGC	1 cut(s)	55
HinP1I	GCGC	1 cut(s)	55
HinfI	GANTC	1 cut(s)	126
Hpy188I	TCNGA	2 cut(s)	247, 283
Hpy188III	TCNNGA	3 cut(s)	109, 338, 364
HpyCH4III	ACNGT	1 cut(s)	83
HpyCH4V	TGCA	7 cut(s)	404, 521, 589, 625, 760, 811, 851
HpyF10VI	GCNNNNNNNGC	1 cut(s)	491
HpyF3I	CTNAG	2 cut(s)	35, 137
Hsp92II	CATG	3 cut(s)	14, 100, 484
HspAI	GCGC	1 cut(s)	55
LmnI	GCTCC	4 cut(s)	277, 499, 755, 804
LpnPI	CCDG	9 cut(s)	9, 100, 122, 151, 317, 377, 705, 788, 815
Lsp1109I	GCAGC	1 cut(s)	620
LweI	GCATC	1 cut(s)	274
MaeI	CTAG	3 cut(s)	558, 605, 773
MboII	GAAGA	2 cut(s)	352, 793
MlsI	TGGCCA	1 cut(s)	118
MluCI	AATT	2 cut(s)	142, 368
MluNI	TGGCCA	1 cut(s)	118
MmeI	TCCRAC	1 cut(s)	201
MnlI	CCTC	8 cut(s)	42, 147, 241, 331, 454, 457, 464, 559
Mox20I	TGGCCA	1 cut(s)	118
MscI	TGGCCA	1 cut(s)	118
MseI	TTAA	3 cut(s)	104, 476, 633
Msp20I	TGGCCA	1 cut(s)	118
MspR9I	CCNGG	1 cut(s)	803
MvaI	CCWGG	1 cut(s)	803
MwoI	GCNNNNNNNGC	1 cut(s)	491
NcoI	CCATGG	1 cut(s)	480
NlaIII	CATG	3 cut(s)	14, 100, 484
NlaIV	GGNNCC	2 cut(s)	30, 486
NsbI	TGCGCA	1 cut(s)	56
PfeI	GAWTC	1 cut(s)	126
PkrI	GCNGC	1 cut(s)	610
PpuMI	RGGWCCY	1 cut(s)	29
Psp5II	RGGWCCY	1 cut(s)	29
Psp6I	CCWGG	1 cut(s)	801
PspFI	CCCAGC	1 cut(s)	331
PspGI	CCWGG	1 cut(s)	801
PspN4I	GGNNCC	2 cut(s)	30, 486
PspPI	GGNCC	2 cut(s)	29, 484
PspPPI	RGGWCCY	1 cut(s)	29
RsaI	GTAC	1 cut(s)	278
RsaNI	GTAC	1 cut(s)	277
SaqAI	TTAA	3 cut(s)	104, 476, 633
SatI	GCNGC	1 cut(s)	609
Sau96I	GGNCC	2 cut(s)	29, 484
ScrFI	CCNGG	1 cut(s)	803
SfaNI	GCATC	1 cut(s)	274
SinI	GGWCC	1 cut(s)	29
SmlI	CTYRAG	1 cut(s)	702
SmoI	CTYRAG	1 cut(s)	702
Sse9I	AATT	2 cut(s)	142, 368
SsiI	CCGC	2 cut(s)	505, 573
SspMI	CTAG	3 cut(s)	558, 605, 773
StyD4I	CCNGG	1 cut(s)	801
StyI	CCWWGG	3 cut(s)	73, 237, 480
TaaI	ACNGT	1 cut(s)	83
TaqI	TCGA	2 cut(s)	124, 765
TasI	AATT	2 cut(s)	142, 368
TfiI	GAWTC	1 cut(s)	126
Tru1I	TTAA	3 cut(s)	104, 476, 633
Tru9I	TTAA	3 cut(s)	104, 476, 633
TscAI	CASTG	2 cut(s)	632, 858
TseI	GCWGC	1 cut(s)	608
TspDTI	ATGAA	2 cut(s)	269, 703
TspGWI	ACGGA	1 cut(s)	264
TspRI	CASTG	2 cut(s)	632, 858
VpaK11BI	GGWCC	1 cut(s)	29
XapI	RAATTY	1 cut(s)	368
XspI	CTAG	3 cut(s)	558, 605, 773

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.