Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0018646.1

Orthogroup ID

OG0009678

Physical Location & Seq

Genomic Coordinates Forward (+)

13959 .. 14312

Gene Structure 354 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0018646.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 354 bp

atgaatgtttctctattggccccttatactatgatggaagttcgggaagcgctcttccaaatgcatccgcccaaagctccggggcaggatggcatgtcacctttcttcttccagaaatattgggatttggttgggaataaggttagcaatgcggttatctcgatgttaactaacttggagatgcctccggatttaaattttacccatgtagtgctgatccccaaactcaaagaagtgacgactatgtcacatttgaaatccattgctttgtgcaatgtgctgtataagattgcttcaaaggttgtggctaacaggttaaagctttttttgccggccattatctctccccaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_2 PfkB TB2_DP1_HVA22

Protein Analysis

117

Amino Acids

13.16

Weight (kDa)

9.37

Isoelectric Point (pI)

36.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009678)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g10222
pyrus_communis	pycom05g03820 pycom13g14160
rosa_chinensis	RchiOBHm_Chr3g0481911 RchiOBHm_Chr7g0230761
rosa_multiflora	Rmu_co8504529.1_g000002 Rmu_sc0001350.1_g000011 Rmu_sc0001847.1_g000004 Rmu_sc0006323.1_g000012 Rmu_sc0007994.1_g000004 Rmu_sc0010800.1_g000001 Rmu_sc0013801.1_g000003 Rmu_sc0018646.1_g000004 Rmu_sc0024195.1_g000003 Rmu_sc0037386.1_g000001 Rmu_sc0040395.1_g000001
rosa_roxburghii	Rroxscaffold_3G00233950 Rroxscaffold_3G00238590 Rroxscaffold_5G00334460 Rroxscaffold_7G00177700 Rroxscaffold_7G00178180
rosa_rugosa	Rorug07G0126600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	244
AccIII	TCCGGA	1 cut(s)	187
AciI	CCGC	2 cut(s)	68, 152
AclWI	GGATC	1 cut(s)	211
AcoI	YGGCCR	1 cut(s)	333
AcsI	RAATTY	1 cut(s)	196
AfeI	AGCGCT	1 cut(s)	51
AgsI	TTSAA	2 cut(s)	256, 297
AluBI	AGCT	2 cut(s)	77, 322
AluI	AGCT	2 cut(s)	77, 322
AlwI	GGATC	1 cut(s)	211
Aor13HI	TCCGGA	1 cut(s)	187
Aor51HI	AGCGCT	1 cut(s)	51
AoxI	GGCC	2 cut(s)	18, 333
ApoI	RAATTY	1 cut(s)	196
AspLEI	GCGC	1 cut(s)	52
AspS9I	GGNCC	1 cut(s)	19
AsuC2I	CCSGG	1 cut(s)	81
AsuHPI	GGTGA	1 cut(s)	90
BccI	CCATC	2 cut(s)	28, 83
BcnI	CCSGG	1 cut(s)	81
BfoI	RGCGCY	1 cut(s)	53
Bme1390I	CCNGG	1 cut(s)	81
BmgT120I	GGNCC	1 cut(s)	19
BmiI	GGNNCC	1 cut(s)	21
BmrFI	CCNGG	1 cut(s)	81
BmsI	GCATC	2 cut(s)	73, 171
BpuMI	CCSGG	1 cut(s)	81
BsaJI	CCNNGG	1 cut(s)	80
BsaWI	WCCGGW	1 cut(s)	187
Bse118I	RCCGGY	1 cut(s)	331
Bse3DI	GCAATG	3 cut(s)	154, 261, 280
BseAI	TCCGGA	1 cut(s)	187
BseDI	CCNNGG	1 cut(s)	80
BseGI	GGATG	2 cut(s)	64, 94
BseMI	GCAATG	3 cut(s)	154, 261, 280
BshFI	GGCC	2 cut(s)	20, 335
BsiSI	CCGG	3 cut(s)	80, 188, 332
BsnI	GGCC	2 cut(s)	20, 335
Bsp13I	TCCGGA	1 cut(s)	187
Bsp143I	GATC	1 cut(s)	216
BspACI	CCGC	2 cut(s)	68, 152
BspANI	GGCC	2 cut(s)	20, 335
BspEI	TCCGGA	1 cut(s)	187
BspLI	GGNNCC	1 cut(s)	21
BspPI	GGATC	1 cut(s)	211
BspQI	GCTCTTC	1 cut(s)	59
BsrDI	GCAATG	3 cut(s)	154, 261, 280
BsrFI	RCCGGY	1 cut(s)	331
BssAI	RCCGGY	1 cut(s)	331
BssECI	CCNNGG	1 cut(s)	80
BssMI	GATC	1 cut(s)	216
Bst6I	CTCTTC	1 cut(s)	59
BstC8I	GCNNGC	1 cut(s)	333
BstF5I	GGATG	2 cut(s)	64, 94
BstH2I	RGCGCY	1 cut(s)	53
BstHHI	GCGC	1 cut(s)	52
BstKTI	GATC	1 cut(s)	219
BstMBI	GATC	1 cut(s)	216
BstMWI	GCNNNNNNNGC	1 cut(s)	328
BstNSI	RCATGY	1 cut(s)	97
BstSCI	CCNGG	1 cut(s)	79
BsuRI	GGCC	2 cut(s)	20, 335
BtsCI	GGATG	2 cut(s)	64, 94
Cac8I	GCNNGC	1 cut(s)	333
CfoI	GCGC	1 cut(s)	52
Cfr10I	RCCGGY	1 cut(s)	331
Cfr13I	GGNCC	1 cut(s)	19
CspCI	CAANNNNNGTGG	2 cut(s)	285, 320
CviAII	CATG	2 cut(s)	94, 206
CviJI	RGCY	5 cut(s)	20, 77, 308, 322, 335
CviKI_1	RGCY	5 cut(s)	20, 77, 308, 322, 335
DpnI	GATC	1 cut(s)	218
DpnII	GATC	1 cut(s)	216
DraI	TTTAAA	1 cut(s)	195
DrdI	GACNNNNNNGTC	1 cut(s)	244
DseDI	GACNNNNNNGTC	1 cut(s)	244
EaeI	YGGCCR	1 cut(s)	333
Eam1104I	CTCTTC	1 cut(s)	59
EarI	CTCTTC	1 cut(s)	59
EciI	GGCGGA	1 cut(s)	57
Eco47III	AGCGCT	1 cut(s)	51
EcoT22I	ATGCAT	1 cut(s)	66
FaeI	CATG	2 cut(s)	97, 209
FaiI	YATR	6 cut(s)	27, 32, 95, 207, 245, 285
FatI	CATG	2 cut(s)	93, 205
FokI	GGATG	2 cut(s)	51, 101
GlaI	GCGC	1 cut(s)	51
HaeII	RGCGCY	1 cut(s)	53
HaeIII	GGCC	2 cut(s)	20, 335
HapII	CCGG	3 cut(s)	80, 188, 332
HhaI	GCGC	1 cut(s)	52
Hin1II	CATG	2 cut(s)	97, 209
Hin6I	GCGC	1 cut(s)	50
HinP1I	GCGC	1 cut(s)	50
HincII	GTYRAC	1 cut(s)	168
HindII	GTYRAC	1 cut(s)	168
HindIII	AAGCTT	1 cut(s)	320
HpaI	GTTAAC	1 cut(s)	168
HpaII	CCGG	3 cut(s)	80, 188, 332
HphI	GGTGA	1 cut(s)	90
Hpy166II	GTNNAC	1 cut(s)	168
Hpy188III	TCNNGA	4 cut(s)	44, 112, 160, 188
Hpy8I	GTNNAC	1 cut(s)	168
HpyCH4V	TGCA	2 cut(s)	64, 273
HpyF10VI	GCNNNNNNNGC	1 cut(s)	328
Hsp92II	CATG	2 cut(s)	97, 209
HspAI	GCGC	1 cut(s)	50
Kpn2I	TCCGGA	1 cut(s)	187
KroI	GCCGGC	1 cut(s)	331
KroNI	GCCGGC	1 cut(s)	333
KspAI	GTTAAC	1 cut(s)	168
Kzo9I	GATC	1 cut(s)	216
LguI	GCTCTTC	1 cut(s)	59
LmnI	GCTCC	1 cut(s)	82
LpnPI	CCDG	6 cut(s)	71, 93, 125, 201, 298, 345
LweI	GCATC	2 cut(s)	73, 171
MaeIII	GTNAC	3 cut(s)	96, 235, 246
MalI	GATC	1 cut(s)	218
MboI	GATC	1 cut(s)	216
MboII	GAAGA	3 cut(s)	46, 97, 100
MluCI	AATT	1 cut(s)	196
MnlI	CCTC	1 cut(s)	195
Mph1103I	ATGCAT	1 cut(s)	66
MroI	TCCGGA	1 cut(s)	187
MroNI	GCCGGC	1 cut(s)	331
MseI	TTAA	3 cut(s)	167, 194, 317
MspI	CCGG	3 cut(s)	80, 188, 332
MspR9I	CCNGG	1 cut(s)	81
MwoI	GCNNNNNNNGC	1 cut(s)	328
NaeI	GCCGGC	1 cut(s)	333
NciI	CCSGG	1 cut(s)	81
NdeII	GATC	1 cut(s)	216
NgoMIV	GCCGGC	1 cut(s)	331
NlaIII	CATG	2 cut(s)	97, 209
NlaIV	GGNNCC	1 cut(s)	21
NmuCI	GTSAC	3 cut(s)	96, 235, 246
NsiI	ATGCAT	1 cut(s)	66
NspI	RCATGY	1 cut(s)	97
PciSI	GCTCTTC	1 cut(s)	59
PdiI	GCCGGC	1 cut(s)	333
PflFI	GACNNNGTC	1 cut(s)	244
PspN4I	GGNNCC	1 cut(s)	21
PspPI	GGNCC	1 cut(s)	19
PsyI	GACNNNGTC	1 cut(s)	244
SapI	GCTCTTC	1 cut(s)	59
SaqAI	TTAA	3 cut(s)	167, 194, 317
Sau3AI	GATC	1 cut(s)	216
Sau96I	GGNCC	1 cut(s)	19
ScrFI	CCNGG	1 cut(s)	81
SetI	ASST	6 cut(s)	79, 103, 144, 303, 317, 324
SfaNI	GCATC	2 cut(s)	73, 171
SmiI	ATTTAAAT	1 cut(s)	195
Sse9I	AATT	1 cut(s)	196
SsiI	CCGC	2 cut(s)	68, 152
SspI	AATATT	1 cut(s)	119
StyD4I	CCNGG	1 cut(s)	79
SwaI	ATTTAAAT	1 cut(s)	195
TaqI	TCGA	1 cut(s)	161
TasI	AATT	1 cut(s)	196
Tru1I	TTAA	3 cut(s)	167, 194, 317
Tru9I	TTAA	3 cut(s)	167, 194, 317
TseFI	GTSAC	3 cut(s)	96, 235, 246
Tsp45I	GTSAC	3 cut(s)	96, 235, 246
TspDTI	ATGAA	1 cut(s)	17
Tth111I	GACNNNGTC	1 cut(s)	244
XapI	RAATTY	1 cut(s)	196
XceI	RCATGY	1 cut(s)	97
Zsp2I	ATGCAT	1 cut(s)	66

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.