Rmu_sc0037386.1_g000001

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0037386.1
OG0009678
Physical Location & Seq
Reverse (-)
665 .. 1038
374 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0037386.1_g000001.1.cds

Sequence Viewer

Length: 261 bp
atgaactccagtcttatagccccatactctgatgatgagatcaagaaggcgttgtttcaaatgcatccctcaaaatcaccaggtcctgatgggatgtccccatgtttcttccaaaaattttggaacgtggttggacatgacgtctgttgtgcagttagagaagtgttgactacgggtagcttccaaggtcctggccaacagactcaagacaattctgcctcacattatttcaccgttacagagtccttttgttccaggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3 zf-RVT

Protein Analysis

86

Amino Acids

9.51

Weight (kDa)

5.78

Isoelectric Point (pI)

51.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 144
AcoI YGGCCR 1 cut(s) 193
AcsI RAATTY 1 cut(s) 116
AcyI GRCGYC 1 cut(s) 141
AgsI TTSAA 1 cut(s) 59
AhdI GACNNNNNGTC 1 cut(s) 140
AjnI CCWGG 3 cut(s) 79, 190, 254
AluBI AGCT 1 cut(s) 180
AluI AGCT 1 cut(s) 180
AlwNI CAGNNNCTG 1 cut(s) 86
AoxI GGCC 1 cut(s) 193
ApoI RAATTY 1 cut(s) 116
AspS9I GGNCC 2 cut(s) 83, 188
AsuHPI GGTGA 2 cut(s) 69, 223
AvaII GGWCC 2 cut(s) 83, 188
BalI TGGCCA 1 cut(s) 195
BccI CCATC 1 cut(s) 83
BciT130I CCWGG 3 cut(s) 81, 192, 256
Bme1390I CCNGG 3 cut(s) 81, 192, 256
Bme18I GGWCC 2 cut(s) 83, 188
BmeRI GACNNNNNGTC 1 cut(s) 140
BmgT120I GGNCC 2 cut(s) 83, 188
BmrFI CCNGG 3 cut(s) 81, 192, 256
BmsI GCATC 1 cut(s) 73
BpuEI CTTGAG 1 cut(s) 189
BsaHI GRCGYC 1 cut(s) 141
BsaJI CCNNGG 1 cut(s) 184
Bse1I ACTGG 1 cut(s) 9
BseBI CCWGG 3 cut(s) 81, 192, 256
BseDI CCNNGG 1 cut(s) 184
BseGI GGATG 2 cut(s) 64, 99
BseNI ACTGG 1 cut(s) 9
BsgI GTGCAG 1 cut(s) 171
BshFI GGCC 1 cut(s) 195
BslFI GGGAC 1 cut(s) 82
BsmFI GGGAC 1 cut(s) 82
BsnI GGCC 1 cut(s) 195
Bsp143I GATC 1 cut(s) 39
BspANI GGCC 1 cut(s) 195
BsrI ACTGG 1 cut(s) 9
BssECI CCNNGG 1 cut(s) 184
BssMI GATC 1 cut(s) 39
BssNI GRCGYC 1 cut(s) 141
BssT1I CCWWGG 1 cut(s) 184
Bst2UI CCWGG 3 cut(s) 81, 192, 256
Bst4CI ACNGT 1 cut(s) 235
BstACI GRCGYC 1 cut(s) 141
BstF5I GGATG 2 cut(s) 64, 99
BstKTI GATC 1 cut(s) 42
BstMBI GATC 1 cut(s) 39
BstNI CCWGG 3 cut(s) 81, 192, 256
BstSCI CCNGG 3 cut(s) 79, 190, 254
BstXI CCANNNNNNTGG 1 cut(s) 191
BsuRI GGCC 1 cut(s) 195
BtsCI GGATG 2 cut(s) 64, 99
CaiI CAGNNNCTG 1 cut(s) 86
Cfr13I GGNCC 2 cut(s) 83, 188
CsiI ACCWGGT 1 cut(s) 79
CviAII CATG 2 cut(s) 102, 137
CviJI RGCY 3 cut(s) 20, 180, 195
CviKI_1 RGCY 3 cut(s) 20, 180, 195
DpnI GATC 1 cut(s) 41
DpnII GATC 1 cut(s) 39
DriI GACNNNNNGTC 1 cut(s) 140
EaeI YGGCCR 1 cut(s) 193
Eam1105I GACNNNNNGTC 1 cut(s) 140
Eco130I CCWWGG 1 cut(s) 184
Eco47I GGWCC 2 cut(s) 83, 188
EcoO109I RGGNCCY 2 cut(s) 83, 188
EcoRII CCWGG 3 cut(s) 79, 190, 254
EcoT14I CCWWGG 1 cut(s) 184
EcoT22I ATGCAT 1 cut(s) 66
ErhI CCWWGG 1 cut(s) 184
FaeI CATG 2 cut(s) 105, 140
FaiI YATR 4 cut(s) 17, 25, 103, 138
FaqI GGGAC 1 cut(s) 82
FatI CATG 2 cut(s) 101, 136
FokI GGATG 2 cut(s) 51, 106
HaeIII GGCC 1 cut(s) 195
Hin1I GRCGYC 1 cut(s) 141
Hin1II CATG 2 cut(s) 105, 140
HincII GTYRAC 1 cut(s) 168
HindII GTYRAC 1 cut(s) 168
HinfI GANTC 2 cut(s) 202, 242
HphI GGTGA 2 cut(s) 69, 223
Hpy166II GTNNAC 1 cut(s) 168
Hpy188I TCNGA 1 cut(s) 31
Hpy188III TCNNGA 3 cut(s) 43, 86, 206
Hpy8I GTNNAC 1 cut(s) 168
HpyAV CCTTC 1 cut(s) 40
HpyCH4III ACNGT 1 cut(s) 235
HpyCH4IV ACGT 2 cut(s) 126, 141
HpyCH4V TGCA 2 cut(s) 64, 152
HpySE526I ACGT 2 cut(s) 126, 141
Hsp92I GRCGYC 1 cut(s) 141
Hsp92II CATG 2 cut(s) 105, 140
Kzo9I GATC 1 cut(s) 39
LpnPI CCDG 7 cut(s) 22, 66, 93, 99, 177, 204, 241
LweI GCATC 1 cut(s) 73
MabI ACCWGGT 1 cut(s) 79
MaeII ACGT 2 cut(s) 126, 141
MaeIII GTNAC 1 cut(s) 235
MalI GATC 1 cut(s) 41
MboI GATC 1 cut(s) 39
MboII GAAGA 1 cut(s) 100
MlsI TGGCCA 1 cut(s) 195
MluCI AATT 2 cut(s) 116, 211
MluNI TGGCCA 1 cut(s) 195
MlyI GAGTC 2 cut(s) 196, 251
MmeI TCCRAC 1 cut(s) 112
MnlI CCTC 2 cut(s) 79, 229
Mox20I TGGCCA 1 cut(s) 195
Mph1103I ATGCAT 1 cut(s) 66
MscI TGGCCA 1 cut(s) 195
Msp20I TGGCCA 1 cut(s) 195
MspR9I CCNGG 3 cut(s) 81, 192, 256
MvaI CCWGG 3 cut(s) 81, 192, 256
NdeII GATC 1 cut(s) 39
NlaIII CATG 2 cut(s) 105, 140
NsiI ATGCAT 1 cut(s) 66
PleI GAGTC 2 cut(s) 196, 250
PpsI GAGTC 2 cut(s) 196, 250
PpuMI RGGWCCY 2 cut(s) 83, 188
Psp5II RGGWCCY 2 cut(s) 83, 188
Psp6I CCWGG 3 cut(s) 79, 190, 254
PspGI CCWGG 3 cut(s) 79, 190, 254
PspPI GGNCC 2 cut(s) 83, 188
PspPPI RGGWCCY 2 cut(s) 83, 188
PstNI CAGNNNCTG 1 cut(s) 86
Sau3AI GATC 1 cut(s) 39
Sau96I GGNCC 2 cut(s) 83, 188
SchI GAGTC 2 cut(s) 196, 251
ScrFI CCNGG 3 cut(s) 81, 192, 256
SetI ASST 6 cut(s) 85, 129, 144, 182, 190, 260
SexAI ACCWGGT 1 cut(s) 79
SfaNI GCATC 1 cut(s) 73
SinI GGWCC 2 cut(s) 83, 188
SmlI CTYRAG 1 cut(s) 204
SmoI CTYRAG 1 cut(s) 204
Sse9I AATT 2 cut(s) 116, 211
StyD4I CCNGG 3 cut(s) 79, 190, 254
StyI CCWWGG 1 cut(s) 184
TaaI ACNGT 1 cut(s) 235
TaiI ACGT 2 cut(s) 129, 144
TasI AATT 2 cut(s) 116, 211
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 2 cut(s) 83, 188
XapI RAATTY 1 cut(s) 116
ZraI GACGTC 1 cut(s) 142
Zsp2I ATGCAT 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.