Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001362.1

Orthogroup ID

OG0004182

Physical Location & Seq

Genomic Coordinates Forward (+)

44954 .. 45472

Gene Structure 519 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001362.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 375 bp

atggagaacgatgaagtatcaactcggccttctttagcttttcctctgggtttggctcttcttctcctcatgctattgagcatcagcaccttcttcttctgctgcctctactgggatagagttcgatctctcttcatatcctctctcgatcaagatcaagacccagaagcaaatttagatcagaaacctgcacgtccgaaaacgatggaaaatcaaaatcaactacagagcttgccagtactgatgcctggagatcaagtgccaaagttcatagcaattgcatgtccctgtgaacttccggcggtggagaagaagatcacggtgatggtagaagagcctacccgtttgtgtcatgctagtactgtatgtagctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

124

Amino Acids

13.9

Weight (kDa)

4.72

Isoelectric Point (pI)

54.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004182)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G65660
fragaria_vesca	FvH4_1g18910 FvH4_1g18910 FvH4_1g18910 FvH4_5g33800 FvH4_5g33800
malus_domestica	MD01G1045700.v1.1 MD08G1207400.v1.1 MD15G1306100.v1.1 MD15G1391900.v1.1
prunus_persica	Prupe.1G540600_v2.0.a1 Prupe.6G210400_v2.0.a1
pyrus_communis	pycom15g35270
rosa_chinensis	RchiOBHm_Chr2g0109921 RchiOBHm_Chr7g0233121
rosa_laevigata	RLG00000001295 RLG00000017769
rosa_multiflora	Rmu_sc0001362.1_g000012 Rmu_sc0005173.1_g000017
rosa_roxburghii	Rroxscaffold_2G00133880 Rroxscaffold_3G00227630
rosa_rugosa	Rorug02G0163800 Rorug07G0278400 Rorug07G0278500 Rorug07G0278600
rosa_samantha	Rh2BG225800 Rh2CG218000 Rh7AG434200 Rh7BG406700 Rh7CG453200 Rh7DG422500
rosa_wichuraiana	Rw2G016660 Rw7G035770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	196
AciI	CCGC	1 cut(s)	302
AcsI	RAATTY	1 cut(s)	172
AfaI	GTAC	2 cut(s)	240, 361
AfiI	CCNNNNNNNGG	1 cut(s)	112
AjiI	CACGTC	1 cut(s)	194
AjnI	CCWGG	1 cut(s)	247
AluBI	AGCT	3 cut(s)	38, 231, 372
AluI	AGCT	3 cut(s)	38, 231, 372
AoxI	GGCC	1 cut(s)	26
ApeKI	GCWGC	1 cut(s)	102
ApoI	RAATTY	1 cut(s)	172
AsuHPI	GGTGA	1 cut(s)	334
BbvI	GCAGC	1 cut(s)	89
BccI	CCATC	2 cut(s)	199, 319
BciT130I	CCWGG	1 cut(s)	249
BfaI	CTAG	2 cut(s)	357, 373
BfmI	CTRYAG	1 cut(s)	224
BfuAI	ACCTGC	1 cut(s)	196
BisI	GCNGC	1 cut(s)	103
BlsI	GCNGC	1 cut(s)	104
BmcAI	AGTACT	2 cut(s)	240, 361
Bme1390I	CCNGG	1 cut(s)	249
BmgBI	CACGTC	1 cut(s)	194
BmrFI	CCNGG	1 cut(s)	249
BmrI	ACTGGG	1 cut(s)	121
BmsI	GCATC	2 cut(s)	90, 234
BmuI	ACTGGG	1 cut(s)	121
BpmI	CTGGAG	1 cut(s)	270
BsaBI	GATNNNNATC	1 cut(s)	153
BsaXI	ACNNNNNCTCC	2 cut(s)	243, 273
Bsc4I	CCNNNNNNNGG	1 cut(s)	112
Bse1I	ACTGG	2 cut(s)	116, 236
Bse8I	GATNNNNATC	1 cut(s)	153
BseBI	CCWGG	1 cut(s)	249
BseJI	GATNNNNATC	1 cut(s)	153
BseLI	CCNNNNNNNGG	1 cut(s)	112
BseNI	ACTGG	2 cut(s)	116, 236
BseRI	GAGGAG	1 cut(s)	56
BseXI	GCAGC	1 cut(s)	89
BsgI	GTGCAG	1 cut(s)	174
BshFI	GGCC	1 cut(s)	28
BsiSI	CCGG	1 cut(s)	299
BslFI	GGGAC	1 cut(s)	270
BslI	CCNNNNNNNGG	1 cut(s)	112
BsmFI	GGGAC	1 cut(s)	270
BsnI	GGCC	1 cut(s)	28
Bsp143I	GATC	6 cut(s)	125, 148, 154, 178, 253, 315
BspACI	CCGC	1 cut(s)	302
BspANI	GGCC	1 cut(s)	28
BspMI	ACCTGC	1 cut(s)	196
BspQI	GCTCTTC	2 cut(s)	63, 327
BsrI	ACTGG	2 cut(s)	116, 236
BssMI	GATC	6 cut(s)	125, 148, 154, 178, 253, 315
Bst2UI	CCWGG	1 cut(s)	249
Bst4CI	ACNGT	2 cut(s)	322, 364
Bst6I	CTCTTC	3 cut(s)	63, 137, 327
BstC8I	GCNNGC	1 cut(s)	233
BstKTI	GATC	6 cut(s)	128, 151, 157, 181, 256, 318
BstMBI	GATC	6 cut(s)	125, 148, 154, 178, 253, 315
BstNI	CCWGG	1 cut(s)	249
BstNSI	RCATGY	1 cut(s)	285
BstSCI	CCNGG	1 cut(s)	247
BstSFI	CTRYAG	1 cut(s)	224
BstV1I	GCAGC	1 cut(s)	89
BsuRI	GGCC	1 cut(s)	28
BtrI	CACGTC	1 cut(s)	194
BveI	ACCTGC	1 cut(s)	196
Cac8I	GCNNGC	1 cut(s)	233
Csp6I	GTAC	2 cut(s)	239, 360
CviAII	CATG	3 cut(s)	70, 282, 353
CviJI	RGCY	6 cut(s)	28, 38, 56, 231, 337, 372
CviKI_1	RGCY	6 cut(s)	28, 38, 56, 231, 337, 372
CviQI	GTAC	2 cut(s)	239, 360
DpnI	GATC	6 cut(s)	127, 150, 156, 180, 255, 317
DpnII	GATC	6 cut(s)	125, 148, 154, 178, 253, 315
Eam1104I	CTCTTC	3 cut(s)	63, 137, 327
EarI	CTCTTC	3 cut(s)	63, 137, 327
EcoRII	CCWGG	1 cut(s)	247
FaeI	CATG	3 cut(s)	73, 285, 356
FaiI	YATR	6 cut(s)	71, 137, 272, 283, 354, 367
FaqI	GGGAC	1 cut(s)	270
FatI	CATG	3 cut(s)	69, 281, 352
Fnu4HI	GCNGC	1 cut(s)	103
Fsp4HI	GCNGC	1 cut(s)	103
FspBI	CTAG	2 cut(s)	357, 373
GluI	GCNGC	1 cut(s)	103
GsuI	CTGGAG	1 cut(s)	270
HaeIII	GGCC	1 cut(s)	28
HapII	CCGG	1 cut(s)	299
Hin1II	CATG	3 cut(s)	73, 285, 356
HpaII	CCGG	1 cut(s)	299
HphI	GGTGA	1 cut(s)	334
Hpy166II	GTNNAC	1 cut(s)	293
Hpy188I	TCNGA	2 cut(s)	183, 198
Hpy188III	TCNNGA	3 cut(s)	146, 152, 158
Hpy8I	GTNNAC	1 cut(s)	293
HpyAV	CCTTC	2 cut(s)	39, 100
HpyCH4III	ACNGT	2 cut(s)	322, 364
HpyCH4IV	ACGT	1 cut(s)	193
HpyCH4V	TGCA	2 cut(s)	191, 281
HpySE526I	ACGT	1 cut(s)	193
Hsp92II	CATG	3 cut(s)	73, 285, 356
Kzo9I	GATC	6 cut(s)	125, 148, 154, 178, 253, 315
LguI	GCTCTTC	2 cut(s)	63, 327
LpnPI	CCDG	9 cut(s)	32, 97, 177, 201, 234, 249, 261, 301, 312
Lsp1109I	GCAGC	1 cut(s)	89
LweI	GCATC	2 cut(s)	90, 234
MaeI	CTAG	2 cut(s)	357, 373
MaeII	ACGT	1 cut(s)	193
MalI	GATC	6 cut(s)	127, 150, 156, 180, 255, 317
MboI	GATC	6 cut(s)	125, 148, 154, 178, 253, 315
MboII	GAAGA	8 cut(s)	50, 53, 85, 88, 124, 322, 325, 344
MfeI	CAATTG	1 cut(s)	276
MluCI	AATT	2 cut(s)	172, 276
MnlI	CCTC	4 cut(s)	54, 77, 116, 151
MslI	CAYNNNNRTG	1 cut(s)	323
MspI	CCGG	1 cut(s)	299
MspR9I	CCNGG	1 cut(s)	249
MunI	CAATTG	1 cut(s)	276
MvaI	CCWGG	1 cut(s)	249
NdeII	GATC	6 cut(s)	125, 148, 154, 178, 253, 315
NlaIII	CATG	3 cut(s)	73, 285, 356
NmeAIII	GCCGAG	1 cut(s)	4
NspI	RCATGY	1 cut(s)	285
PciSI	GCTCTTC	2 cut(s)	63, 327
PkrI	GCNGC	1 cut(s)	104
Psp6I	CCWGG	1 cut(s)	247
PspGI	CCWGG	1 cut(s)	247
RsaI	GTAC	2 cut(s)	240, 361
RsaNI	GTAC	2 cut(s)	239, 360
RseI	CAYNNNNRTG	1 cut(s)	323
SapI	GCTCTTC	2 cut(s)	63, 327
SatI	GCNGC	1 cut(s)	103
Sau3AI	GATC	6 cut(s)	125, 148, 154, 178, 253, 315
ScaI	AGTACT	2 cut(s)	240, 361
ScrFI	CCNGG	1 cut(s)	249
SetI	ASST	6 cut(s)	40, 92, 190, 196, 233, 374
SfaNI	GCATC	2 cut(s)	90, 234
SfcI	CTRYAG	1 cut(s)	224
SmiMI	CAYNNNNRTG	1 cut(s)	323
Sse9I	AATT	2 cut(s)	172, 276
SsiI	CCGC	1 cut(s)	302
SspMI	CTAG	2 cut(s)	357, 373
StyD4I	CCNGG	1 cut(s)	247
TaaI	ACNGT	2 cut(s)	322, 364
TaiI	ACGT	1 cut(s)	196
TaqI	TCGA	2 cut(s)	124, 147
TasI	AATT	2 cut(s)	172, 276
TatI	WGTACW	2 cut(s)	238, 359
TseI	GCWGC	1 cut(s)	102
TspDTI	ATGAA	3 cut(s)	27, 124, 259
XapI	RAATTY	1 cut(s)	172
XceI	RCATGY	1 cut(s)	285
XspI	CTAG	2 cut(s)	357, 373
ZrmI	AGTACT	2 cut(s)	240, 361

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.