Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001362.1

Orthogroup ID

OG0010625

Physical Location & Seq

Genomic Coordinates Forward (+)

53017 .. 56690

Gene Structure 3674 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 522 bp

atgggcagagccaaagccagaggagacccaaagctgaaggtgaagcagccctacttgggaaaaaaagagcctttgtgcagatatgttcgggtacttggtgcattttacttgcgtatcacaggcagcgatactgatgtctaccagtacctagagcctctgtacaatgactatcggaagttgagaagtaaattggctgatggacgtttctcgttgactcatgtggatgagcttattgatgaacttctgacaaaggactactcatgcgacattgccatgccacgaatcaagaaaagggctggtggagggttcaaagcccaggcccggccagcaacctggcttattaaagcccacctggcctggccttataagcccagctcggaagcccattcaattctagtatccgttgggcacgaggtagggctggtggagggttcaaagcccaagcccggccagcaacctggcttattaaagcccacctggcctggccttataagcccagctcggaagcccattcaattctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005681 GO:0032991 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0071011 GO:1990904

KEGG Pathways

Metabolic & Signaling

ko03040 map03040

Pfam Domains

Protein Families

PRP38 PRP38_assoc

Protein Analysis

173

Amino Acids

19.43

Weight (kDa)

9.85

Isoelectric Point (pI)

25.23

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
PRP38	PF03371	26 - 98	5.7e-25	PRP38 family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010625)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0035011
rosa_multiflora	Rmu_co8511997.1_g000001 Rmu_sc0001362.1_g000014 Rmu_sc0010150.1_g000001
rosa_roxburghii	Rroxscaffold_2G00124430 Rroxscaffold_4G00289780 Rroxscaffold_4G00312070
rosa_rugosa	Rorug07G0045100
rosa_samantha	Rh1AG348800 Rh1CG225700 Rh2AG087200 Rh2DG085800 Rh2DG094600 Rh4AG035100 Rh4AG055900 Rh4AG165800 Rh4BG054200 Rh7AG188300 Rh7CG325800 Rh7DG293800 Rh7DG422400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	366, 491
AccI	GTMKAC	1 cut(s)	138
AcoI	YGGCCR	2 cut(s)	323, 448
AcuI	CTGAAG	1 cut(s)	56
AfaI	GTAC	3 cut(s)	93, 146, 161
AfiI	CCNNNNNNNGG	3 cut(s)	56, 321, 446
AgsI	TTSAA	4 cut(s)	310, 390, 435, 515
AjnI	CCWGG	7 cut(s)	315, 332, 351, 356, 457, 476, 481
AluBI	AGCT	4 cut(s)	34, 229, 375, 500
AluI	AGCT	4 cut(s)	34, 229, 375, 500
Alw26I	GTCTC	1 cut(s)	18
AoxI	GGCC	7 cut(s)	318, 323, 354, 359, 448, 479, 484
ApeKI	GCWGC	2 cut(s)	46, 123
AspS9I	GGNCC	1 cut(s)	319
AsuC2I	CCSGG	2 cut(s)	322, 447
AsuHPI	GGTGA	1 cut(s)	52
BaeGI	GKGCMC	1 cut(s)	411
BaeI	ACNNNNGTAYC	4 cut(s)	97, 120, 130, 153
BarI	GAAGNNNNNNTAC	2 cut(s)	35, 67
BauI	CACGAG	1 cut(s)	410
BbvI	GCAGC	2 cut(s)	58, 135
BccI	CCATC	1 cut(s)	191
BciT130I	CCWGG	7 cut(s)	317, 334, 353, 358, 459, 478, 483
BciVI	GTATCC	1 cut(s)	409
BcnI	CCSGG	2 cut(s)	322, 447
BcoDI	GTCTC	1 cut(s)	18
BfaI	CTAG	3 cut(s)	149, 395, 520
BfuI	GTATCC	1 cut(s)	409
BglI	GCCNNNNNGGC	2 cut(s)	353, 478
BisI	GCNGC	2 cut(s)	47, 124
BlsI	GCNGC	2 cut(s)	48, 125
Bme1390I	CCNGG	9 cut(s)	317, 322, 334, 353, 358, 447, 459, 478, 483
BmgT120I	GGNCC	1 cut(s)	319
BmrFI	CCNGG	9 cut(s)	317, 322, 334, 353, 358, 447, 459, 478, 483
BpuMI	CCSGG	2 cut(s)	322, 447
BsaI	GGTCTC	1 cut(s)	18
BsaJI	CCNNGG	1 cut(s)	315
Bsc4I	CCNNNNNNNGG	3 cut(s)	56, 321, 446
Bse1I	ACTGG	1 cut(s)	142
Bse3DI	GCAATG	1 cut(s)	267
BseBI	CCWGG	7 cut(s)	317, 334, 353, 358, 459, 478, 483
BseDI	CCNNGG	1 cut(s)	315
BseGI	GGATG	1 cut(s)	229
BseLI	CCNNNNNNNGG	3 cut(s)	56, 321, 446
BseMI	GCAATG	1 cut(s)	267
BseNI	ACTGG	1 cut(s)	142
BseRI	GAGGAG	1 cut(s)	36
BseSI	GKGCMC	1 cut(s)	411
BseXI	GCAGC	2 cut(s)	58, 135
BseYI	CCCAGC	2 cut(s)	371, 496
BsgI	GTGCAG	1 cut(s)	97
BshFI	GGCC	7 cut(s)	320, 325, 356, 361, 450, 481, 486
BsiSI	CCGG	2 cut(s)	322, 447
BslI	CCNNNNNNNGG	3 cut(s)	56, 321, 446
BsmAI	GTCTC	1 cut(s)	18
BsnI	GGCC	7 cut(s)	320, 325, 356, 361, 450, 481, 486
Bso31I	GGTCTC	1 cut(s)	18
Bsp1286I	GDGCHC	1 cut(s)	411
Bsp1407I	TGTACA	1 cut(s)	159
BspANI	GGCC	7 cut(s)	320, 325, 356, 361, 450, 481, 486
BspTNI	GGTCTC	1 cut(s)	18
BsrDI	GCAATG	1 cut(s)	267
BsrGI	TGTACA	1 cut(s)	159
BsrI	ACTGG	1 cut(s)	142
BssECI	CCNNGG	1 cut(s)	315
BssSI	CACGAG	1 cut(s)	410
Bst2BI	CACGAG	1 cut(s)	410
Bst2UI	CCWGG	7 cut(s)	317, 334, 353, 358, 459, 478, 483
BstAUI	TGTACA	1 cut(s)	159
BstC8I	GCNNGC	2 cut(s)	327, 452
BstF5I	GGATG	1 cut(s)	229
BstMAI	GTCTC	1 cut(s)	18
BstMWI	GCNNNNNNNGC	6 cut(s)	326, 353, 367, 451, 478, 492
BstNI	CCWGG	7 cut(s)	317, 334, 353, 358, 459, 478, 483
BstSCI	CCNGG	9 cut(s)	315, 320, 332, 351, 356, 445, 457, 476, 481
BstSLI	GKGCMC	1 cut(s)	411
BstV1I	GCAGC	2 cut(s)	58, 135
BstXI	CCANNNNNNTGG	2 cut(s)	333, 458
BsuI	GTATCC	1 cut(s)	409
BsuRI	GGCC	7 cut(s)	320, 325, 356, 361, 450, 481, 486
BtsCI	GGATG	1 cut(s)	229
Cac8I	GCNNGC	2 cut(s)	327, 452
Cfr13I	GGNCC	1 cut(s)	319
Csp6I	GTAC	3 cut(s)	92, 145, 160
CviAII	CATG	3 cut(s)	218, 261, 274
CviQI	GTAC	3 cut(s)	92, 145, 160
EaeI	YGGCCR	2 cut(s)	323, 448
Eco31I	GGTCTC	1 cut(s)	18
Eco57I	CTGAAG	1 cut(s)	56
EcoRII	CCWGG	7 cut(s)	315, 332, 351, 356, 457, 476, 481
FaeI	CATG	3 cut(s)	221, 264, 277
FaiI	YATR	6 cut(s)	84, 219, 262, 275, 366, 491
FatI	CATG	3 cut(s)	217, 260, 273
FblI	GTMKAC	1 cut(s)	138
Fnu4HI	GCNGC	2 cut(s)	47, 124
FokI	GGATG	1 cut(s)	236
Fsp4HI	GCNGC	2 cut(s)	47, 124
FspBI	CTAG	3 cut(s)	149, 395, 520
GluI	GCNGC	2 cut(s)	47, 124
GsaI	CCCAGC	2 cut(s)	375, 500
HaeIII	GGCC	7 cut(s)	320, 325, 356, 361, 450, 481, 486
HapII	CCGG	2 cut(s)	322, 447
Hin1II	CATG	3 cut(s)	221, 264, 277
HincII	GTYRAC	1 cut(s)	213
HindII	GTYRAC	1 cut(s)	213
HinfI	GANTC	2 cut(s)	214, 282
HpaII	CCGG	2 cut(s)	322, 447
HphI	GGTGA	1 cut(s)	52
Hpy166II	GTNNAC	2 cut(s)	139, 213
Hpy188I	TCNGA	4 cut(s)	174, 246, 379, 504
Hpy188III	TCNNGA	1 cut(s)	286
Hpy8I	GTNNAC	2 cut(s)	139, 213
HpyAV	CCTTC	1 cut(s)	31
HpyCH4IV	ACGT	1 cut(s)	202
HpyCH4V	TGCA	2 cut(s)	78, 101
HpyF10VI	GCNNNNNNNGC	6 cut(s)	326, 353, 367, 451, 478, 492
HpySE526I	ACGT	1 cut(s)	202
Hsp92II	CATG	3 cut(s)	221, 264, 277
Lsp1109I	GCAGC	2 cut(s)	58, 135
MaeI	CTAG	3 cut(s)	149, 395, 520
MaeII	ACGT	1 cut(s)	202
MhlI	GDGCHC	1 cut(s)	411
MluCI	AATT	3 cut(s)	188, 390, 515
MlyI	GAGTC	1 cut(s)	208
MnlI	CCTC	5 cut(s)	14, 165, 296, 406, 421
MseI	TTAA	2 cut(s)	342, 467
MslI	CAYNNNNRTG	2 cut(s)	222, 272
MspI	CCGG	2 cut(s)	322, 447
MspR9I	CCNGG	9 cut(s)	317, 322, 334, 353, 358, 447, 459, 478, 483
MvaI	CCWGG	7 cut(s)	317, 334, 353, 358, 459, 478, 483
MwoI	GCNNNNNNNGC	6 cut(s)	326, 353, 367, 451, 478, 492
NciI	CCSGG	2 cut(s)	322, 447
NlaIII	CATG	3 cut(s)	221, 264, 277
PfeI	GAWTC	1 cut(s)	282
PkrI	GCNGC	2 cut(s)	48, 125
PleI	GAGTC	1 cut(s)	208
PpsI	GAGTC	1 cut(s)	208
PsiI	TTATAA	2 cut(s)	366, 491
Psp6I	CCWGG	7 cut(s)	315, 332, 351, 356, 457, 476, 481
PspFI	CCCAGC	2 cut(s)	371, 496
PspGI	CCWGG	7 cut(s)	315, 332, 351, 356, 457, 476, 481
PspPI	GGNCC	1 cut(s)	319
RsaI	GTAC	3 cut(s)	93, 146, 161
RsaNI	GTAC	3 cut(s)	92, 145, 160
RseI	CAYNNNNRTG	2 cut(s)	222, 272
SaqAI	TTAA	2 cut(s)	342, 467
SatI	GCNGC	2 cut(s)	47, 124
Sau96I	GGNCC	1 cut(s)	319
SchI	GAGTC	1 cut(s)	208
ScrFI	CCNGG	9 cut(s)	317, 322, 334, 353, 358, 447, 459, 478, 483
SduI	GDGCHC	1 cut(s)	411
SmiMI	CAYNNNNRTG	2 cut(s)	222, 272
Sse9I	AATT	3 cut(s)	188, 390, 515
SspMI	CTAG	3 cut(s)	149, 395, 520
StyD4I	CCNGG	9 cut(s)	315, 320, 332, 351, 356, 445, 457, 476, 481
TaiI	ACGT	1 cut(s)	205
TasI	AATT	3 cut(s)	188, 390, 515
TatI	WGTACW	1 cut(s)	159
TfiI	GAWTC	1 cut(s)	282
Tru1I	TTAA	2 cut(s)	342, 467
Tru9I	TTAA	2 cut(s)	342, 467
TseI	GCWGC	2 cut(s)	46, 123
TspDTI	ATGAA	1 cut(s)	252
TspGWI	ACGGA	1 cut(s)	391
XmiI	GTMKAC	1 cut(s)	138
XspI	CTAG	3 cut(s)	149, 395, 520

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.