Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001983.1

Orthogroup ID

OG0004527

Physical Location & Seq

Genomic Coordinates Forward (+)

7647 .. 9035

Gene Structure 1389 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001983.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1389 bp

atggagtttcatggagatcaaagaaacctctggagcttcatggatgaagaaagaaagagcatcaagttacctcggagactttcctttggtagtaaccaacaacaaagttcatcatccgaagtacctaacattcacttagcttctgcagcaagaccttctaatgctgcttcagaaccatcaattgatgcaattcctcccagacctatgagccccagcacgccatggacactctccccggtgcgcacttctccttcccaacctcttctttatcattgcatagcctccctccaccgccatgaaggtaacattttctccatcacactctcaaaagatttcatattcaccggctcagaaagtagccggattcatgcttggaagcaaccagattgcaccgagataggttacataaaggctacttcgggtcaagttcgagccatattggcctatgggaaactgctgttcaccacacatggtgactgcaaaattcgggtatgggatgcatcatccacagagaattttagacctaagaagatcacaagtttaccacaaagaaatcgattctctaatttgttttcaaaaaagagcagccagcaacacaatgatcacatctcttgcctcgcttacaacaaagaagacaagctgttgtacacaggctcgtgggacaaatctgttaaagcttggaagataaacgaaaagcgttgtgtcgactcgttcattgctcatgaaggtcatgtgaacgggattgtgatcaaccaggaagatgggtgtgttttcacttgctcatcagatggctcagtcaaaatttggagaagggtgtttggtgaaagttcacacatactcaccatgaccctgaagtttcaactttcaccagtgaatgccttggcattgagcttgtcaaatagcaccaccctcctctactctggctcatcggatgggctcataaacttctgggaaaaagagaagatgtctggaagatacaaccatggtgggtttctgcaaggtcatcatttcgccgttctttgcttggtagccttgggagaactaatcttcagtggctctgaggatgcaaccattagggtttggaggagagaggaaggaaattgcttccattcttgtctttctgtcattgagggacatcacgggccggttagatgcttagcagtgtctttggaaacagaaaatgtggtaagggtaaagggtttgttggtttatagtgcaagcttagaccaaacttttaaggtgtggagggttaaggtttttccaactgagaaactaaacttggatgagtctgcaaaagatccacaaagagagattttggagtgcgagacaagtccagtgctgtcaccttcatgggtggagaaaaagcttcagggcaactttttccagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00565 ko01100 map00565 map01100

Pfam Domains

Protein Families

WD40

Protein Analysis

462

Amino Acids

51.95

Weight (kDa)

8.63

Isoelectric Point (pI)

52.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004527)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g35690 FvH4_6g31961
malus_domestica	MD08G1115200.v1.1 MD09G1207500.v1.1 MD17G1188800.v1.1
prunus_persica	Prupe.1G449400_v2.0.a1 Prupe.3G063300_v2.0.a1
pyrus_communis	pycom09g12370
rosa_chinensis	RchiOBHm_Chr2g0139471 RchiOBHm_Chr6g0306111
rosa_laevigata	RLG00000010824 RLG00000019813
rosa_multiflora	Rmu_sc0000785.1_g000023 Rmu_sc0000903.1_g000022 Rmu_sc0001983.1_g000002
rosa_roxburghii	Rroxscaffold_2G00105410 Rroxscaffold_7G00162050
rosa_rugosa	Rorug06G0282100 Rorug06G0346800
rosa_samantha	Rh2AG407500 Rh2BG418100 Rh2CG393500 Rh2DG426900 Rh6AG459200 Rh6BG441700 Rh6CG473700 Rh6DG459900
rosa_wichuraiana	Rw2G033010 Rw2G033270 Rw6G006540 Rw6G040030 Rw7G016590

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	242
AccI	GTMKAC	1 cut(s)	705
AciI	CCGC	1 cut(s)	292
AclWI	GGATC	1 cut(s)	1292
AcsI	RAATTY	3 cut(s)	483, 514, 801
AcuI	CTGAAG	4 cut(s)	153, 872, 1033, 1352
AdeI	CACNNNGTG	1 cut(s)	473
AfaI	GTAC	2 cut(s)	123, 647
AgsI	TTSAA	2 cut(s)	576, 860
AjnI	CCWGG	1 cut(s)	753
AjuI	GAANNNNNNNTTGG	2 cut(s)	1262, 1294
AluBI	AGCT	7 cut(s)	36, 140, 640, 677, 891, 1221, 1366
AluI	AGCT	7 cut(s)	36, 140, 640, 677, 891, 1221, 1366
Alw26I	GTCTC	2 cut(s)	70, 1319
AlwI	GGATC	1 cut(s)	1292
AoxI	GGCC	2 cut(s)	441, 1142
ApeKI	GCWGC	3 cut(s)	146, 164, 585
ApoI	RAATTY	3 cut(s)	483, 514, 801
AspLEI	GCGC	1 cut(s)	243
AspS9I	GGNCC	1 cut(s)	1142
AsuC2I	CCSGG	1 cut(s)	236
AsuHPI	GGTGA	7 cut(s)	334, 454, 485, 832, 833, 858, 1335
BanII	GRGCYC	2 cut(s)	212, 939
BauI	CACGAG	1 cut(s)	655
BbsI	GAAGAC	1 cut(s)	639
BbvI	GCAGC	3 cut(s)	151, 158, 597
BccI	CCATC	5 cut(s)	184, 323, 755, 782, 926
BceAI	ACGGC	1 cut(s)	998
BciT130I	CCWGG	1 cut(s)	755
BclI	TGATCA	2 cut(s)	601, 747
BcnI	CCSGG	1 cut(s)	236
BcoDI	GTCTC	2 cut(s)	70, 1319
BfmI	CTRYAG	1 cut(s)	144
BglI	GCCNNNNNGGC	1 cut(s)	440
BisI	GCNGC	3 cut(s)	147, 165, 586
BlpI	GCTNAGC	1 cut(s)	1156
BlsI	GCNGC	3 cut(s)	148, 166, 587
Bme1390I	CCNGG	2 cut(s)	236, 755
BmgT120I	GGNCC	1 cut(s)	1142
BmrFI	CCNGG	2 cut(s)	236, 755
BmsI	GCATC	6 cut(s)	69, 175, 487, 509, 1054, 1142
BpiI	GAAGAC	1 cut(s)	639
BpmI	CTGGAG	1 cut(s)	52
Bpu1102I	GCTNAGC	1 cut(s)	1156
BpuMI	CCSGG	1 cut(s)	236
Bsa29I	ATCGAT	1 cut(s)	556
BsaBI	GATNNNNATC	1 cut(s)	746
BsaJI	CCNNGG	6 cut(s)	71, 221, 234, 879, 982, 1032
BsaXI	ACNNNNNCTCC	2 cut(s)	296, 326
Bse118I	RCCGGY	2 cut(s)	344, 1144
Bse1I	ACTGG	3 cut(s)	869, 1334, 1384
Bse3DI	GCAATG	2 cut(s)	271, 714
Bse8I	GATNNNNATC	1 cut(s)	746
BseBI	CCWGG	1 cut(s)	755
BseCI	ATCGAT	1 cut(s)	556
BseDI	CCNNGG	6 cut(s)	71, 221, 234, 879, 982, 1032
BseGI	GGATG	7 cut(s)	49, 113, 502, 503, 937, 1069, 1288
BseJI	GATNNNNATC	1 cut(s)	746
BseMI	GCAATG	2 cut(s)	271, 714
BseMII	CTCAG	4 cut(s)	363, 807, 1050, 1257
BseNI	ACTGG	3 cut(s)	869, 1334, 1384
BseRI	GAGGAG	2 cut(s)	902, 1099
BseXI	GCAGC	3 cut(s)	151, 158, 597
BseYI	CCCAGC	1 cut(s)	212
BshFI	GGCC	2 cut(s)	443, 1144
BshVI	ATCGAT	1 cut(s)	556
BsiSI	CCGG	4 cut(s)	236, 345, 361, 1145
BslFI	GGGAC	2 cut(s)	674, 1146
BsmAI	GTCTC	2 cut(s)	70, 1319
BsmFI	GGGAC	2 cut(s)	674, 1146
BsmI	GAATGC	1 cut(s)	880
BsnI	GGCC	2 cut(s)	443, 1144
Bsp1286I	GDGCHC	2 cut(s)	212, 939
Bsp1407I	TGTACA	1 cut(s)	645
Bsp143I	GATC	5 cut(s)	16, 531, 601, 747, 1297
Bsp1720I	GCTNAGC	1 cut(s)	1156
Bsp19I	CCATGG	2 cut(s)	221, 982
BspACI	CCGC	1 cut(s)	292
BspANI	GGCC	2 cut(s)	443, 1144
BspCNI	CTCAG	4 cut(s)	362, 806, 1051, 1258
BspDI	ATCGAT	1 cut(s)	556
BspHI	TCATGA	1 cut(s)	721
BspMAI	CTGCAG	1 cut(s)	148
BspPI	GGATC	1 cut(s)	1292
BsrDI	GCAATG	2 cut(s)	271, 714
BsrFI	RCCGGY	2 cut(s)	344, 1144
BsrGI	TGTACA	1 cut(s)	645
BsrI	ACTGG	3 cut(s)	869, 1334, 1384
BssAI	RCCGGY	2 cut(s)	344, 1144
BssECI	CCNNGG	6 cut(s)	71, 221, 234, 879, 982, 1032
BssMI	GATC	5 cut(s)	16, 531, 601, 747, 1297
BssSI	CACGAG	1 cut(s)	655
BssT1I	CCWWGG	4 cut(s)	221, 879, 982, 1032
Bst2BI	CACGAG	1 cut(s)	655
Bst2UI	CCWGG	1 cut(s)	755
Bst6I	CTCTTC	1 cut(s)	267
BstAUI	TGTACA	1 cut(s)	645
BstC8I	GCNNGC	3 cut(s)	218, 590, 1219
BstDEI	CTNAG	8 cut(s)	136, 349, 525, 793, 1059, 1156, 1222, 1266
BstDSI	CCRYGG	2 cut(s)	221, 982
BstF5I	GGATG	7 cut(s)	49, 113, 502, 503, 937, 1069, 1288
BstHHI	GCGC	1 cut(s)	243
BstKTI	GATC	5 cut(s)	19, 534, 604, 750, 1300
BstMAI	GTCTC	2 cut(s)	70, 1319
BstMBI	GATC	5 cut(s)	16, 531, 601, 747, 1297
BstMWI	GCNNNNNNNGC	2 cut(s)	146, 440
BstNI	CCWGG	1 cut(s)	755
BstSCI	CCNGG	2 cut(s)	234, 753
BstSFI	CTRYAG	1 cut(s)	144
BstV1I	GCAGC	3 cut(s)	151, 158, 597
BstV2I	GAAGAC	1 cut(s)	639
BstX2I	RGATCY	1 cut(s)	1297
BstXI	CCANNNNNNTGG	1 cut(s)	761
BstYI	RGATCY	1 cut(s)	1297
Bsu15I	ATCGAT	1 cut(s)	556
BsuRI	GGCC	2 cut(s)	443, 1144
BsuTUI	ATCGAT	1 cut(s)	556
BtgI	CCRYGG	2 cut(s)	221, 982
BtsCI	GGATG	7 cut(s)	49, 113, 502, 503, 937, 1069, 1288
BtsI	GCAGTG	1 cut(s)	1167
BtsIMutI	CAGTG	4 cut(s)	876, 1057, 1167, 1341
Cac8I	GCNNGC	3 cut(s)	218, 590, 1219
CciI	TCATGA	1 cut(s)	721
CfoI	GCGC	1 cut(s)	243
Cfr10I	RCCGGY	2 cut(s)	344, 1144
Cfr13I	GGNCC	1 cut(s)	1142
ClaI	ATCGAT	1 cut(s)	556
Csp6I	GTAC	2 cut(s)	122, 646
CspCI	CAANNNNNGTGG	2 cut(s)	967, 1002
CviQI	GTAC	2 cut(s)	122, 646
DdeI	CTNAG	8 cut(s)	136, 349, 525, 793, 1059, 1156, 1222, 1266
DpnI	GATC	5 cut(s)	18, 533, 603, 749, 1299
DpnII	GATC	5 cut(s)	16, 531, 601, 747, 1297
DraIII	CACNNNGTG	1 cut(s)	473
Eam1104I	CTCTTC	1 cut(s)	267
EarI	CTCTTC	1 cut(s)	267
Eco130I	CCWWGG	4 cut(s)	221, 879, 982, 1032
Eco24I	GRGCYC	2 cut(s)	212, 939
Eco57I	CTGAAG	4 cut(s)	153, 872, 1033, 1352
EcoRII	CCWGG	1 cut(s)	753
EcoT14I	CCWWGG	4 cut(s)	221, 879, 982, 1032
EcoT22I	ATGCAT	1 cut(s)	502
EcoT38I	GRGCYC	2 cut(s)	212, 939
ErhI	CCWWGG	4 cut(s)	221, 879, 982, 1032
FaqI	GGGAC	2 cut(s)	674, 1146
FbaI	TGATCA	2 cut(s)	601, 747
FblI	GTMKAC	1 cut(s)	705
Fnu4HI	GCNGC	3 cut(s)	147, 165, 586
FokI	GGATG	7 cut(s)	56, 100, 490, 509, 944, 1076, 1295
FriOI	GRGCYC	2 cut(s)	212, 939
Fsp4HI	GCNGC	3 cut(s)	147, 165, 586
FspAI	RTGCGCAY	1 cut(s)	242
FspI	TGCGCA	1 cut(s)	242
GlaI	GCGC	1 cut(s)	242
GluI	GCNGC	3 cut(s)	147, 165, 586
GsaI	CCCAGC	1 cut(s)	216
GsuI	CTGGAG	1 cut(s)	52
HaeIII	GGCC	2 cut(s)	443, 1144
HapII	CCGG	4 cut(s)	236, 345, 361, 1145
HhaI	GCGC	1 cut(s)	243
Hin6I	GCGC	1 cut(s)	241
HinP1I	GCGC	1 cut(s)	241
HincII	GTYRAC	1 cut(s)	706
HindII	GTYRAC	1 cut(s)	706
HindIII	AAGCTT	3 cut(s)	675, 1219, 1364
HinfI	GANTC	4 cut(s)	364, 558, 707, 1286
HpaII	CCGG	4 cut(s)	236, 345, 361, 1145
HphI	GGTGA	7 cut(s)	334, 454, 485, 832, 833, 858, 1335
Hpy166II	GTNNAC	6 cut(s)	462, 542, 648, 706, 736, 830
Hpy188I	TCNGA	7 cut(s)	75, 118, 172, 352, 787, 931, 1060
Hpy188III	TCNNGA	3 cut(s)	31, 722, 969
Hpy8I	GTNNAC	6 cut(s)	462, 542, 648, 706, 736, 830
HpyAV	CCTTC	7 cut(s)	165, 261, 293, 719, 804, 1088, 1356
HpyF10VI	GCNNNNNNNGC	2 cut(s)	146, 440
HpyF3I	CTNAG	8 cut(s)	136, 349, 525, 793, 1059, 1156, 1222, 1266
HspAI	GCGC	1 cut(s)	241
Ksp22I	TGATCA	2 cut(s)	601, 747
Kzo9I	GATC	5 cut(s)	16, 531, 601, 747, 1297
LmnI	GCTCC	1 cut(s)	33
Lsp1109I	GCAGC	3 cut(s)	151, 158, 597
LweI	GCATC	6 cut(s)	69, 175, 487, 509, 1054, 1142
MaeIII	GTNAC	6 cut(s)	66, 92, 302, 401, 473, 1341
MalI	GATC	5 cut(s)	18, 533, 603, 749, 1299
MboI	GATC	5 cut(s)	16, 531, 601, 747, 1297
MboII	GAAGA	9 cut(s)	59, 254, 541, 644, 694, 770, 973, 984, 1039
MfeI	CAATTG	1 cut(s)	180
MflI	RGATCY	1 cut(s)	1297
MhlI	GDGCHC	2 cut(s)	212, 939
MluCI	AATT	7 cut(s)	180, 189, 483, 514, 565, 801, 1099
MlyI	GAGTC	2 cut(s)	701, 1295
MmeI	TCCRAC	1 cut(s)	1286
Mph1103I	ATGCAT	1 cut(s)	502
MseI	TTAA	3 cut(s)	672, 1236, 1251
MslI	CAYNNNNRTG	2 cut(s)	294, 1348
MspI	CCGG	4 cut(s)	236, 345, 361, 1145
MspR9I	CCNGG	2 cut(s)	236, 755
MunI	CAATTG	1 cut(s)	180
Mva1269I	GAATGC	1 cut(s)	880
MvaI	CCWGG	1 cut(s)	755
MwoI	GCNNNNNNNGC	2 cut(s)	146, 440
NciI	CCSGG	1 cut(s)	236
NcoI	CCATGG	2 cut(s)	221, 982
NdeII	GATC	5 cut(s)	16, 531, 601, 747, 1297
NmuCI	GTSAC	2 cut(s)	473, 1341
NsbI	TGCGCA	1 cut(s)	242
NsiI	ATGCAT	1 cut(s)	502
PagI	TCATGA	1 cut(s)	721
PctI	GAATGC	1 cut(s)	880
PfeI	GAWTC	2 cut(s)	364, 558
PkrI	GCNGC	3 cut(s)	148, 166, 587
PleI	GAGTC	2 cut(s)	701, 1294
PpsI	GAGTC	2 cut(s)	701, 1294
Psp6I	CCWGG	1 cut(s)	753
PspFI	CCCAGC	1 cut(s)	212
PspGI	CCWGG	1 cut(s)	753
PspPI	GGNCC	1 cut(s)	1142
PstI	CTGCAG	1 cut(s)	148
PsuI	RGATCY	1 cut(s)	1297
RsaI	GTAC	2 cut(s)	123, 647
RsaNI	GTAC	2 cut(s)	122, 646
RseI	CAYNNNNRTG	2 cut(s)	294, 1348
SalI	GTCGAC	1 cut(s)	704
SaqAI	TTAA	3 cut(s)	672, 1236, 1251
SatI	GCNGC	3 cut(s)	147, 165, 586
Sau3AI	GATC	5 cut(s)	16, 531, 601, 747, 1297
Sau96I	GGNCC	1 cut(s)	1142
SchI	GAGTC	2 cut(s)	701, 1295
ScrFI	CCNGG	2 cut(s)	236, 755
SduI	GDGCHC	2 cut(s)	212, 939
SfaNI	GCATC	6 cut(s)	69, 175, 487, 509, 1054, 1142
SfcI	CTRYAG	1 cut(s)	144
SmiMI	CAYNNNNRTG	2 cut(s)	294, 1348
Sse9I	AATT	7 cut(s)	180, 189, 483, 514, 565, 801, 1099
SsiI	CCGC	1 cut(s)	292
StyD4I	CCNGG	2 cut(s)	234, 753
StyI	CCWWGG	4 cut(s)	221, 879, 982, 1032
TaqI	TCGA	3 cut(s)	430, 556, 705
TasI	AATT	7 cut(s)	180, 189, 483, 514, 565, 801, 1099
TatI	WGTACW	1 cut(s)	645
TfiI	GAWTC	2 cut(s)	364, 558
Tru1I	TTAA	3 cut(s)	672, 1236, 1251
Tru9I	TTAA	3 cut(s)	672, 1236, 1251
TscAI	CASTG	4 cut(s)	876, 1057, 1167, 1341
TseFI	GTSAC	2 cut(s)	473, 1341
TseI	GCWGC	3 cut(s)	146, 164, 585
Tsp45I	GTSAC	2 cut(s)	473, 1341
TspDTI	ATGAA	9 cut(s)	28, 60, 99, 312, 325, 356, 703, 738, 1338
TspRI	CASTG	4 cut(s)	876, 1057, 1167, 1341
XapI	RAATTY	3 cut(s)	483, 514, 801
XmiI	GTMKAC	1 cut(s)	705
Zsp2I	ATGCAT	1 cut(s)	502

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.