Rmu_sc0001993.1_g000024

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001993.1
Physical Location & Seq
Forward (+)
81425 .. 81794
370 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001993.1_g000024.1.cds

Sequence Viewer

Length: 264 bp
atgctggggctgtctggggaaataaaggaagccgggattgacccggatttggtttcttacaatatatcattgatgggtttggggaggtcagaaaatattgaggagtctttgaggttcttcgatgagatgatggagaggcggattcagccttcgttgtatctttatagagcagtgatcagtaatttgaaagatggggaaggtggagatggaagtgactttcatggaggagatgagttgatgtgcttcaagtcttgccagtcctag

Protein Analysis

87

Amino Acids

9.67

Weight (kDa)

4.4

Isoelectric Point (pI)

54.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 139
AfiI CCNNNNNNNGG 1 cut(s) 49
AgsI TTSAA 2 cut(s) 187, 247
AsuC2I CCSGG 2 cut(s) 34, 44
BccI CCATC 4 cut(s) 67, 124, 185, 200
BclI TGATCA 1 cut(s) 174
BcnI CCSGG 2 cut(s) 34, 44
BfaI CTAG 1 cut(s) 262
Bme1390I CCNGG 2 cut(s) 34, 44
BmrFI CCNGG 2 cut(s) 34, 44
BpuMI CCSGG 2 cut(s) 34, 44
Bsc4I CCNNNNNNNGG 1 cut(s) 49
Bse1I ACTGG 1 cut(s) 256
BseLI CCNNNNNNNGG 1 cut(s) 49
BseNI ACTGG 1 cut(s) 256
BseRI GAGGAG 2 cut(s) 116, 240
BseYI CCCAGC 1 cut(s) 4
BsiSI CCGG 2 cut(s) 33, 44
BslI CCNNNNNNNGG 1 cut(s) 49
Bsp143I GATC 1 cut(s) 174
BspACI CCGC 1 cut(s) 139
BsrI ACTGG 1 cut(s) 256
BssMI GATC 1 cut(s) 174
BstKTI GATC 1 cut(s) 177
BstMBI GATC 1 cut(s) 174
BstMWI GCNNNNNNNGC 1 cut(s) 145
BstSCI CCNGG 2 cut(s) 32, 42
BtsI GCAGTG 1 cut(s) 177
BtsIMutI CAGTG 1 cut(s) 177
CviAII CATG 1 cut(s) 221
CviJI RGCY 3 cut(s) 10, 32, 148
CviKI_1 RGCY 3 cut(s) 10, 32, 148
DpnI GATC 1 cut(s) 176
DpnII GATC 1 cut(s) 174
EciI GGCGGA 1 cut(s) 154
FaeI CATG 1 cut(s) 224
FaiI YATR 3 cut(s) 65, 165, 222
FatI CATG 1 cut(s) 220
FbaI TGATCA 1 cut(s) 174
FspBI CTAG 1 cut(s) 262
GsaI CCCAGC 1 cut(s) 8
HapII CCGG 2 cut(s) 33, 44
Hin1II CATG 1 cut(s) 224
HinfI GANTC 2 cut(s) 104, 142
HpaII CCGG 2 cut(s) 33, 44
Hpy188I TCNGA 1 cut(s) 91
HpyAV CCTTC 2 cut(s) 159, 191
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
Hsp92II CATG 1 cut(s) 224
Ksp22I TGATCA 1 cut(s) 174
Kzo9I GATC 1 cut(s) 174
LpnPI CCDG 2 cut(s) 46, 57
MaeI CTAG 1 cut(s) 262
MaeIII GTNAC 1 cut(s) 212
MalI GATC 1 cut(s) 176
MboI GATC 1 cut(s) 174
MboII GAAGA 1 cut(s) 109
MluCI AATT 1 cut(s) 181
MlyI GAGTC 1 cut(s) 113
MnlI CCTC 5 cut(s) 78, 94, 105, 129, 218
MspI CCGG 2 cut(s) 33, 44
MspR9I CCNGG 2 cut(s) 34, 44
MwoI GCNNNNNNNGC 1 cut(s) 145
NciI CCSGG 2 cut(s) 34, 44
NdeII GATC 1 cut(s) 174
NlaIII CATG 1 cut(s) 224
NmuCI GTSAC 1 cut(s) 212
PfeI GAWTC 1 cut(s) 142
PleI GAGTC 1 cut(s) 112
PpsI GAGTC 1 cut(s) 112
PspFI CCCAGC 1 cut(s) 4
Sau3AI GATC 1 cut(s) 174
SchI GAGTC 1 cut(s) 113
ScrFI CCNGG 2 cut(s) 34, 44
SetI ASST 3 cut(s) 89, 116, 202
SgeI CNNG 8 cut(s) 17, 27, 45, 46, 55, 56, 233, 259
Sse9I AATT 1 cut(s) 181
SsiI CCGC 1 cut(s) 139
SspI AATATT 1 cut(s) 97
SspMI CTAG 1 cut(s) 262
StyD4I CCNGG 2 cut(s) 32, 42
TaqI TCGA 1 cut(s) 120
TasI AATT 1 cut(s) 181
TfiI GAWTC 1 cut(s) 142
TscAI CASTG 1 cut(s) 177
TseFI GTSAC 1 cut(s) 212
Tsp45I GTSAC 1 cut(s) 212
TspDTI ATGAA 1 cut(s) 209
TspRI CASTG 1 cut(s) 177
XspI CTAG 1 cut(s) 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.