Rmu_sc0011563.1_g000011

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011563.1
Physical Location & Seq
Reverse (-)
30044 .. 30493
450 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011563.1_g000011.1.cds

Sequence Viewer

Length: 450 bp
atgtacacatacaacactgttcttgagatattgggccgggcgggtcggacaggtgagatgctgggggtgtttggggaaatgaaggaagctgggattgacccggatttggtttcttacaatacagtgataaaccatgtgaggaagtttggggaagttgatatgtgcttgttgtatttcaaggaaatgtgtgaaaagggtgttcagcctgatttgcttacttacactgcagtcattgatgggttggggaggtcaggagacatagaggagtcgttgaagttgtttggtgagatgaaggagaggcggattcggccttcgttgtatctttatagagcagtgattagtaatttcaagaagatggggaaggtggagatggcggcgagttttatggaggagatgaattcgtgtgcttcaagtcttcgtgctagtagtaaatcgaataaatgcgagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

149

Amino Acids

16.78

Weight (kDa)

5.96

Isoelectric Point (pI)

30.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 41, 301, 374
AcsI RAATTY 1 cut(s) 397
AfaI GTAC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 106
AgsI TTSAA 4 cut(s) 178, 274, 349, 411
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Alw26I GTCTC 1 cut(s) 249
AoxI GGCC 2 cut(s) 34, 308
ApoI RAATTY 1 cut(s) 397
AspS9I GGNCC 1 cut(s) 34
AsuC2I CCSGG 2 cut(s) 38, 101
AsuHPI GGTGA 2 cut(s) 65, 296
BbsI GAAGAC 1 cut(s) 407
BccI CCATC 3 cut(s) 230, 349, 364
BcnI CCSGG 2 cut(s) 38, 101
BcoDI GTCTC 1 cut(s) 249
BfaI CTAG 1 cut(s) 423
BfmI CTRYAG 1 cut(s) 225
BisI GCNGC 1 cut(s) 375
BlsI GCNGC 1 cut(s) 376
Bme1390I CCNGG 2 cut(s) 38, 101
BmgT120I GGNCC 1 cut(s) 34
BmrFI CCNGG 2 cut(s) 38, 101
BmsI GCATC 1 cut(s) 48
BpiI GAAGAC 1 cut(s) 407
BpuEI CTTGAG 1 cut(s) 44
BpuMI CCSGG 2 cut(s) 38, 101
Bsc4I CCNNNNNNNGG 1 cut(s) 106
BseLI CCNNNNNNNGG 1 cut(s) 106
BseRI GAGGAG 2 cut(s) 278, 404
BseYI CCCAGC 2 cut(s) 61, 89
BshFI GGCC 2 cut(s) 36, 310
BsiSI CCGG 2 cut(s) 37, 101
BslI CCNNNNNNNGG 1 cut(s) 106
BsmAI GTCTC 1 cut(s) 249
BsnI GGCC 2 cut(s) 36, 310
Bsp1407I TGTACA 1 cut(s) 3
BspACI CCGC 3 cut(s) 41, 301, 374
BspANI GGCC 2 cut(s) 36, 310
BspMAI CTGCAG 1 cut(s) 229
BsrGI TGTACA 1 cut(s) 3
Bst4CI ACNGT 2 cut(s) 19, 124
BstAUI TGTACA 1 cut(s) 3
BstMAI GTCTC 1 cut(s) 249
BstMWI GCNNNNNNNGC 2 cut(s) 211, 307
BstSCI CCNGG 2 cut(s) 36, 99
BstSFI CTRYAG 1 cut(s) 225
BstV2I GAAGAC 1 cut(s) 407
BsuRI GGCC 2 cut(s) 36, 310
BtsI GCAGTG 2 cut(s) 222, 339
BtsIMutI CAGTG 4 cut(s) 15, 129, 222, 339
Cfr13I GGNCC 1 cut(s) 34
Csp6I GTAC 1 cut(s) 4
CviAII CATG 1 cut(s) 134
CviJI RGCY 4 cut(s) 36, 89, 205, 310
CviKI_1 RGCY 4 cut(s) 36, 89, 205, 310
CviQI GTAC 1 cut(s) 4
EciI GGCGGA 1 cut(s) 316
EcoRI GAATTC 1 cut(s) 397
FaeI CATG 1 cut(s) 137
FaiI YATR 6 cut(s) 10, 135, 161, 260, 327, 386
FatI CATG 1 cut(s) 133
FauI CCCGC 1 cut(s) 34
Fnu4HI GCNGC 1 cut(s) 375
Fsp4HI GCNGC 1 cut(s) 375
FspBI CTAG 1 cut(s) 423
GluI GCNGC 1 cut(s) 375
GsaI CCCAGC 2 cut(s) 65, 93
HaeIII GGCC 2 cut(s) 36, 310
HapII CCGG 2 cut(s) 37, 101
Hin1II CATG 1 cut(s) 137
HinfI GANTC 2 cut(s) 266, 304
HpaII CCGG 2 cut(s) 37, 101
HphI GGTGA 2 cut(s) 65, 296
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 48
Hpy188III TCNNGA 3 cut(s) 23, 252, 349
Hpy8I GTNNAC 1 cut(s) 6
HpyAV CCTTC 4 cut(s) 76, 286, 321, 355
HpyCH4III ACNGT 2 cut(s) 19, 124
HpyCH4V TGCA 1 cut(s) 227
HpyF10VI GCNNNNNNNGC 2 cut(s) 211, 307
Hsp92II CATG 1 cut(s) 137
LpnPI CCDG 7 cut(s) 36, 47, 50, 75, 114, 219, 237
LweI GCATC 1 cut(s) 48
MaeI CTAG 1 cut(s) 423
MboII GAAGA 2 cut(s) 364, 407
MluCI AATT 2 cut(s) 343, 397
MlyI GAGTC 1 cut(s) 275
MmeI TCCRAC 1 cut(s) 26
MnlI CCTC 5 cut(s) 132, 240, 256, 291, 382
MspI CCGG 2 cut(s) 37, 101
MspR9I CCNGG 2 cut(s) 38, 101
MwoI GCNNNNNNNGC 2 cut(s) 211, 307
NciI CCSGG 2 cut(s) 38, 101
NlaIII CATG 1 cut(s) 137
PfeI GAWTC 1 cut(s) 304
PkrI GCNGC 1 cut(s) 376
PleI GAGTC 1 cut(s) 274
PpsI GAGTC 1 cut(s) 274
PspFI CCCAGC 2 cut(s) 61, 89
PspPI GGNCC 1 cut(s) 34
PstI CTGCAG 1 cut(s) 229
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SatI GCNGC 1 cut(s) 375
Sau96I GGNCC 1 cut(s) 34
SchI GAGTC 1 cut(s) 275
ScrFI CCNGG 2 cut(s) 38, 101
SetI ASST 4 cut(s) 55, 91, 251, 366
SfaNI GCATC 1 cut(s) 48
SfcI CTRYAG 1 cut(s) 225
SmlI CTYRAG 1 cut(s) 23
SmoI CTYRAG 1 cut(s) 23
Sse9I AATT 2 cut(s) 343, 397
SsiI CCGC 3 cut(s) 41, 301, 374
SspMI CTAG 1 cut(s) 423
StyD4I CCNGG 2 cut(s) 36, 99
TaaI ACNGT 2 cut(s) 19, 124
TaqI TCGA 1 cut(s) 434
TasI AATT 2 cut(s) 343, 397
TatI WGTACW 1 cut(s) 3
TauI GCSGC 1 cut(s) 377
TfiI GAWTC 1 cut(s) 304
TscAI CASTG 4 cut(s) 22, 129, 229, 339
TspDTI ATGAA 3 cut(s) 95, 305, 410
TspRI CASTG 4 cut(s) 22, 129, 229, 339
XapI RAATTY 1 cut(s) 397
XspI CTAG 1 cut(s) 423
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.