Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002169.1

Orthogroup ID

OG0008144

Physical Location & Seq

Genomic Coordinates Forward (+)

83768 .. 84956

Gene Structure 1189 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002169.1_g000018.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1071 bp

atggcttttcaaaataaccttgttataattgccattttatctatcatcttgggggcaacggcacaacctccagccacggccaacgatgaagttgatccctctacatttttgaaaacatttgagcaatggatggcacagttcggacgcacttacggtgacaatgcagagaaagaaaggcgtctcaccatattcgtgaagaacttgttatttgtaaataacttcaacagccaagggaataagacttacaagttaagcgtcaacttgttttctgatatggccaatgaagaatttctcggactttacactggatttcaagctcccaatgtcaccttaaactcaagctcattccgtggacaacgtaatatgaaatcttttaggtaccaagacctgtctgaaactgatgttccgactagaattgactggagggaacaaggtgctgttacccccgtcaaggaacaaggacaatgcacagtggcagcaattgagggcattaccaaaatcaaaagtaaccaattgatttcactgtccgagcaacaacttgtggactgtaacagagatcaaattaacaagggctgcggtggtggtaatatggaagatgcctttaaatacataaatgacaacggaggaatcactagtgaagaaaactaccaatacaagggtgcagaagagacatgtgacactactaagacgactgaatatgctgccaagataaacggttatgaaatggttcctcccaacagcgaaaatgatctactaaaggccgtggccaagcaaccagtctcagtcgcccttgatgccgatggagctgaatttagggcatacgcaagtggggtattttctggtaattgcgggacaaaactaacccatgctgttacaatcgttgggtacggaacgactgaagaaggcaccaactattggttagtgaagaattcatggggcgaaacctggggtgaaaagggctacatgagaattcttcgaaatgctggtcctccaggaggtttgtgtggcattgctatgtacccttcttatccaactgcatcagctatggcacccgctccctcaccactgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04140 ko04142 ko04145 ko04210 ko04612 ko04621 ko04924 ko05205 ko05323 ko05418 map04140 map04142 map04145 map04210 map04612 map04621 map04924 map05205 map05323 map05418

Pfam Domains

Protein Families

Granulin Inhibitor_I29 Peptidase_C1

Protein Analysis

356

Amino Acids

39.01

Weight (kDa)

4.98

Isoelectric Point (pI)

34.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008144)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g06040
rosa_chinensis	RchiOBHm_Chr3g0455011 RchiOBHm_Chr3g0455051 RchiOBHm_Chr3g0455061
rosa_laevigata	RLG00000025390 RLG00000025392 RLG00000025393
rosa_multiflora	Rmu_sc0002169.1_g000011 Rmu_sc0002169.1_g000016 Rmu_sc0002169.1_g000018
rosa_roxburghii	Rroxscaffold_6G00424580
rosa_rugosa	Rorug03G0004000 Rorug03G0004000
rosa_samantha	Rh3AG063600 Rh3AG063700 Rh3AG064000 Rh3AG064200 Rh3BG065500 Rh3BG065600 Rh3BG065900 Rh3BG066000
rosa_wichuraiana	Rw3G005000 Rw3G005010 Rw3G005030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	26
Acc65I	GGTACC	1 cut(s)	378
AccB1I	GGYRCC	3 cut(s)	378, 905, 1048
AccB7I	CCANNNNNTGG	1 cut(s)	915
AccBSI	CCGCTC	1 cut(s)	1055
AciI	CCGC	3 cut(s)	576, 849, 1053
AclWI	GGATC	1 cut(s)	89
AcoI	YGGCCR	3 cut(s)	78, 276, 765
AcsI	RAATTY	4 cut(s)	287, 809, 928, 969
AcuI	CTGAAG	1 cut(s)	918
AcyI	GRCGYC	1 cut(s)	178
AfaI	GTAC	3 cut(s)	380, 887, 1019
AfiI	CCNNNNNNNGG	4 cut(s)	451, 655, 915, 995
AflIII	ACRYGT	1 cut(s)	671
AgsI	TTSAA	4 cut(s)	11, 112, 223, 314
AhlI	ACTAGT	1 cut(s)	632
AjnI	CCWGG	2 cut(s)	944, 991
AluBI	AGCT	4 cut(s)	317, 342, 806, 1043
AluI	AGCT	4 cut(s)	317, 342, 806, 1043
Alw26I	GTCTC	3 cut(s)	185, 662, 784
AlwI	GGATC	1 cut(s)	89
AoxI	GGCC	4 cut(s)	78, 276, 759, 765
ApeKI	GCWGC	3 cut(s)	476, 573, 701
ApoI	RAATTY	4 cut(s)	287, 809, 928, 969
ArsI	GACNNNNNNTTYG	2 cut(s)	970, 1002
Asp700I	GAANNNNTTC	2 cut(s)	288, 726
Asp718I	GGTACC	1 cut(s)	378
AspS9I	GGNCC	1 cut(s)	986
AsuHPI	GGTGA	5 cut(s)	167, 175, 319, 962, 1053
AsuII	TTCGAA	1 cut(s)	976
AvaII	GGWCC	1 cut(s)	986
BalI	TGGCCA	2 cut(s)	278, 767
BanI	GGYRCC	3 cut(s)	378, 905, 1048
BbvI	GCAGC	3 cut(s)	488, 560, 688
BccI	CCATC	2 cut(s)	124, 794
BceAI	ACGGC	3 cut(s)	75, 93, 746
BciT130I	CCWGG	2 cut(s)	946, 993
BcoDI	GTCTC	3 cut(s)	185, 662, 784
BcuI	ACTAGT	1 cut(s)	632
BfaI	CTAG	2 cut(s)	411, 633
BfmI	CTRYAG	1 cut(s)	1067
BisI	GCNGC	3 cut(s)	477, 574, 702
BlsI	GCNGC	3 cut(s)	478, 575, 703
Bme1390I	CCNGG	2 cut(s)	946, 993
Bme18I	GGWCC	1 cut(s)	986
BmgT120I	GGNCC	1 cut(s)	986
BmiI	GGNNCC	4 cut(s)	380, 729, 907, 1050
BmrFI	CCNGG	2 cut(s)	946, 993
BmsI	GCATC	3 cut(s)	586, 784, 1046
BpmI	CTGGAG	3 cut(s)	54, 442, 975
Bpu14I	TTCGAA	1 cut(s)	976
BpuEI	CTTGAG	1 cut(s)	322
BsaHI	GRCGYC	1 cut(s)	178
BsaJI	CCNNGG	5 cut(s)	75, 229, 349, 762, 945
Bsc4I	CCNNNNNNNGG	4 cut(s)	451, 655, 915, 995
Bse1I	ACTGG	3 cut(s)	310, 425, 776
Bse3DI	GCAATG	2 cut(s)	131, 1008
BseBI	CCWGG	2 cut(s)	946, 993
BseDI	CCNNGG	5 cut(s)	75, 229, 349, 762, 945
BseGI	GGATG	1 cut(s)	135
BseLI	CCNNNNNNNGG	4 cut(s)	451, 655, 915, 995
BseMI	GCAATG	2 cut(s)	131, 1008
BseMII	CTCAG	1 cut(s)	795
BseNI	ACTGG	3 cut(s)	310, 425, 776
BseXI	GCAGC	3 cut(s)	488, 560, 688
BsgI	GTGCAG	1 cut(s)	681
BshFI	GGCC	4 cut(s)	80, 278, 761, 767
BshNI	GGYRCC	3 cut(s)	378, 905, 1048
BslFI	GGGAC	1 cut(s)	865
BslI	CCNNNNNNNGG	4 cut(s)	451, 655, 915, 995
BsmAI	GTCTC	3 cut(s)	185, 662, 784
BsmBI	CGTCTC	1 cut(s)	185
BsmFI	GGGAC	1 cut(s)	865
BsnI	GGCC	4 cut(s)	80, 278, 761, 767
Bsp119I	TTCGAA	1 cut(s)	976
Bsp143I	GATC	3 cut(s)	94, 556, 748
BspACI	CCGC	3 cut(s)	576, 849, 1053
BspANI	GGCC	4 cut(s)	80, 278, 761, 767
BspCNI	CTCAG	1 cut(s)	794
BspLI	GGNNCC	4 cut(s)	380, 729, 907, 1050
BspPI	GGATC	1 cut(s)	89
BspT104I	TTCGAA	1 cut(s)	976
BspT107I	GGYRCC	3 cut(s)	378, 905, 1048
BsrBI	CCGCTC	1 cut(s)	1055
BsrDI	GCAATG	2 cut(s)	131, 1008
BsrI	ACTGG	3 cut(s)	310, 425, 776
BssECI	CCNNGG	5 cut(s)	75, 229, 349, 762, 945
BssMI	GATC	3 cut(s)	94, 556, 748
BssNI	GRCGYC	1 cut(s)	178
BssT1I	CCWWGG	1 cut(s)	229
Bst2UI	CCWGG	2 cut(s)	946, 993
Bst4CI	ACNGT	7 cut(s)	138, 155, 472, 525, 548, 716, 1068
Bst6I	CTCTTC	1 cut(s)	660
BstACI	GRCGYC	1 cut(s)	178
BstBI	TTCGAA	1 cut(s)	976
BstDEI	CTNAG	2 cut(s)	684, 781
BstDSI	CCRYGG	3 cut(s)	75, 349, 762
BstENI	CCTNNNNNAGG	1 cut(s)	993
BstF5I	GGATG	1 cut(s)	135
BstKTI	GATC	3 cut(s)	97, 559, 751
BstMAI	GTCTC	3 cut(s)	185, 662, 784
BstMBI	GATC	3 cut(s)	94, 556, 748
BstMWI	GCNNNNNNNGC	2 cut(s)	794, 803
BstNI	CCWGG	2 cut(s)	946, 993
BstNSI	RCATGY	1 cut(s)	675
BstSCI	CCNGG	2 cut(s)	944, 991
BstSFI	CTRYAG	1 cut(s)	1067
BstV1I	GCAGC	3 cut(s)	488, 560, 688
BsuRI	GGCC	4 cut(s)	80, 278, 761, 767
BtgI	CCRYGG	3 cut(s)	75, 349, 762
BtsCI	GGATG	1 cut(s)	135
BtsIMutI	CAGTG	4 cut(s)	303, 477, 521, 1064
Cfr13I	GGNCC	1 cut(s)	986
CseI	GACGC	3 cut(s)	153, 167, 244
Csp6I	GTAC	3 cut(s)	379, 886, 1018
CviAII	CATG	4 cut(s)	672, 866, 933, 964
CviQI	GTAC	3 cut(s)	379, 886, 1018
DdeI	CTNAG	2 cut(s)	684, 781
DpnI	GATC	3 cut(s)	96, 558, 750
DpnII	GATC	3 cut(s)	94, 556, 748
DraI	TTTAAA	1 cut(s)	604
EaeI	YGGCCR	3 cut(s)	78, 276, 765
Eam1104I	CTCTTC	1 cut(s)	660
EarI	CTCTTC	1 cut(s)	660
Eco130I	CCWWGG	1 cut(s)	229
Eco47I	GGWCC	1 cut(s)	986
Eco57I	CTGAAG	1 cut(s)	918
EcoNI	CCTNNNNNAGG	1 cut(s)	993
EcoRI	GAATTC	2 cut(s)	928, 969
EcoRII	CCWGG	2 cut(s)	944, 991
EcoT14I	CCWWGG	1 cut(s)	229
ErhI	CCWWGG	1 cut(s)	229
Esp3I	CGTCTC	1 cut(s)	185
FaeI	CATG	4 cut(s)	675, 869, 936, 967
FaqI	GGGAC	1 cut(s)	865
FatI	CATG	4 cut(s)	671, 865, 932, 963
FauI	CCCGC	2 cut(s)	842, 1060
Fnu4HI	GCNGC	3 cut(s)	477, 574, 702
FokI	GGATG	1 cut(s)	142
Fsp4HI	GCNGC	3 cut(s)	477, 574, 702
FspBI	CTAG	2 cut(s)	411, 633
GluI	GCNGC	3 cut(s)	477, 574, 702
GsuI	CTGGAG	3 cut(s)	54, 442, 975
HaeIII	GGCC	4 cut(s)	80, 278, 761, 767
HgaI	GACGC	3 cut(s)	153, 167, 244
Hin1I	GRCGYC	1 cut(s)	178
Hin1II	CATG	4 cut(s)	675, 869, 936, 967
HincII	GTYRAC	1 cut(s)	259
HindII	GTYRAC	1 cut(s)	259
HinfI	GANTC	1 cut(s)	627
HphI	GGTGA	5 cut(s)	167, 175, 319, 962, 1053
Hpy166II	GTNNAC	3 cut(s)	259, 353, 544
Hpy188I	TCNGA	6 cut(s)	143, 271, 296, 394, 408, 529
Hpy188III	TCNNGA	1 cut(s)	193
Hpy8I	GTNNAC	3 cut(s)	259, 353, 544
HpyAV	CCTTC	2 cut(s)	896, 1032
HpyCH4III	ACNGT	7 cut(s)	138, 155, 472, 525, 548, 716, 1068
HpyCH4IV	ACGT	1 cut(s)	358
HpyCH4V	TGCA	4 cut(s)	164, 468, 662, 1037
HpyF10VI	GCNNNNNNNGC	2 cut(s)	794, 803
HpyF3I	CTNAG	2 cut(s)	684, 781
HpySE526I	ACGT	1 cut(s)	358
Hsp92I	GRCGYC	1 cut(s)	178
Hsp92II	CATG	4 cut(s)	675, 869, 936, 967
KpnI	GGTACC	1 cut(s)	382
Kzo9I	GATC	3 cut(s)	94, 556, 748
LmnI	GCTCC	3 cut(s)	322, 803, 1060
Lsp1109I	GCAGC	3 cut(s)	488, 560, 688
LweI	GCATC	3 cut(s)	586, 784, 1046
MaeI	CTAG	2 cut(s)	411, 633
MaeII	ACGT	1 cut(s)	358
MaeIII	GTNAC	7 cut(s)	155, 325, 439, 506, 548, 674, 871
MalI	GATC	3 cut(s)	96, 558, 750
MbiI	CCGCTC	1 cut(s)	1055
MboI	GATC	3 cut(s)	94, 556, 748
MboII	GAAGA	8 cut(s)	208, 296, 605, 650, 677, 911, 937, 965
MfeI	CAATTG	2 cut(s)	480, 512
MlsI	TGGCCA	2 cut(s)	278, 767
MluNI	TGGCCA	2 cut(s)	278, 767
MmeI	TCCRAC	2 cut(s)	431, 1055
MnlI	CCTC	9 cut(s)	78, 109, 417, 478, 617, 741, 989, 999, 1069
Mox20I	TGGCCA	2 cut(s)	278, 767
MroXI	GAANNNNTTC	2 cut(s)	288, 726
MscI	TGGCCA	2 cut(s)	278, 767
MseI	TTAA	4 cut(s)	251, 332, 564, 603
MslI	CAYNNNNRTG	2 cut(s)	191, 1013
Msp20I	TGGCCA	2 cut(s)	278, 767
MspR9I	CCNGG	2 cut(s)	946, 993
MunI	CAATTG	2 cut(s)	480, 512
MvaI	CCWGG	2 cut(s)	946, 993
MwoI	GCNNNNNNNGC	2 cut(s)	794, 803
NdeII	GATC	3 cut(s)	94, 556, 748
NlaIII	CATG	4 cut(s)	675, 869, 936, 967
NlaIV	GGNNCC	4 cut(s)	380, 729, 907, 1050
NmuCI	GTSAC	3 cut(s)	155, 325, 674
NspI	RCATGY	1 cut(s)	675
NspV	TTCGAA	1 cut(s)	976
PciI	ACATGT	1 cut(s)	671
PdmI	GAANNNNTTC	2 cut(s)	288, 726
PfeI	GAWTC	1 cut(s)	627
PflMI	CCANNNNNTGG	1 cut(s)	915
PfoI	TCCNGGA	1 cut(s)	991
PkrI	GCNGC	3 cut(s)	478, 575, 703
PscI	ACATGT	1 cut(s)	671
PsiI	TTATAA	1 cut(s)	26
Psp6I	CCWGG	2 cut(s)	944, 991
PspGI	CCWGG	2 cut(s)	944, 991
PspN4I	GGNNCC	4 cut(s)	380, 729, 907, 1050
PspPI	GGNCC	1 cut(s)	986
RsaI	GTAC	3 cut(s)	380, 887, 1019
RsaNI	GTAC	3 cut(s)	379, 886, 1018
RseI	CAYNNNNRTG	2 cut(s)	191, 1013
SaqAI	TTAA	4 cut(s)	251, 332, 564, 603
SatI	GCNGC	3 cut(s)	477, 574, 702
Sau3AI	GATC	3 cut(s)	94, 556, 748
Sau96I	GGNCC	1 cut(s)	986
ScrFI	CCNGG	2 cut(s)	946, 993
SfaNI	GCATC	3 cut(s)	586, 784, 1046
SfcI	CTRYAG	1 cut(s)	1067
SfuI	TTCGAA	1 cut(s)	976
SinI	GGWCC	1 cut(s)	986
SmiMI	CAYNNNNRTG	2 cut(s)	191, 1013
SmlI	CTYRAG	1 cut(s)	337
SmoI	CTYRAG	1 cut(s)	337
SpeI	ACTAGT	1 cut(s)	632
SsiI	CCGC	3 cut(s)	576, 849, 1053
SspMI	CTAG	2 cut(s)	411, 633
StyD4I	CCNGG	2 cut(s)	944, 991
StyI	CCWWGG	1 cut(s)	229
TaaI	ACNGT	7 cut(s)	138, 155, 472, 525, 548, 716, 1068
TaiI	ACGT	1 cut(s)	361
TaqI	TCGA	1 cut(s)	976
TfiI	GAWTC	1 cut(s)	627
Tru1I	TTAA	4 cut(s)	251, 332, 564, 603
Tru9I	TTAA	4 cut(s)	251, 332, 564, 603
TscAI	CASTG	4 cut(s)	310, 477, 528, 1071
TseFI	GTSAC	3 cut(s)	155, 325, 674
TseI	GCWGC	3 cut(s)	476, 573, 701
Tsp45I	GTSAC	3 cut(s)	155, 325, 674
TspDTI	ATGAA	5 cut(s)	102, 297, 380, 735, 921
TspGWI	ACGGA	3 cut(s)	338, 636, 903
TspRI	CASTG	4 cut(s)	310, 477, 528, 1071
Van91I	CCANNNNNTGG	1 cut(s)	915
VpaK11BI	GGWCC	1 cut(s)	986
XagI	CCTNNNNNAGG	1 cut(s)	993
XapI	RAATTY	4 cut(s)	287, 809, 928, 969
XceI	RCATGY	1 cut(s)	675
XmnI	GAANNNNTTC	2 cut(s)	288, 726
XspI	CTAG	2 cut(s)	411, 633

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.