Rh3BG065900

cysteine-type peptidase activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
4416613 .. 4417441
829 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG065900.1

Sequence Viewer

Length: 732 bp
ATGGCTTTTCAAAATAACCTTGTTATAATTGCCATTTTATCTATCATCTTGGGGGCAATGGCACAACCCCCAGCAACGTCCAACGATGAAGTTGATCCCTCTACATTTTTGAAAACATTTGAGCAATGGATGGCACAGTTCGGACGCACTTACGGTGACAATGCAGAGAAAGAAAGGCGTCTCACCATATTCGTGAAGAACTTGTTATTTGTAAATAACTTCAACAGCCAAGGGAATAAGACTTACAAGTTAAGCGTCAACTTGTTTTCTGATATGGCCAATGAAGAATTTCTCGGACTTTACACTGGATTTCAAGCTCCCAATGTCACCTTAAACTCAAGCTCATTCCGTGGACAACGTAATATCAAATATTTTAGGTACCAAGACCTGTCTGAAACTGATGTTCCGACTAGAATTGACTGGAGGGAACAAGGTGCTGTTACCCCCGTCAAGGAACAAGGACAATGCCGTTCTTGTTGGGCATTTTCAGCAGTGGCAACAATTGAGGGCATTACCAAAATCAAAAGTAACCAATTGATTTCACTGTCCGAGCAACAACTTGTGGACTGTAACAGAGATCAAATTAACAAGGGCTGCAGTGGTGGTAATATGGAAGATGCCTTTAAATACATAAATGACAACGGAGGAATCACTAGTGAAGAAAACTACCATACAAGGGTGCAGAAGAGACATGTGACACTACTAAGACGACTGAATATGCTGCCAAGATAA
Functional Annotation

Protein Analysis

243

Amino Acids

27.65

Weight (kDa)

8.31

Isoelectric Point (pI)

41.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Inhibitor_I29 PF08246 40 - 97 2.2e-18 Cathepsin propeptide inhibitor domain (I29)
Peptidase_C1 PF00112 135 - 224 4.9e-36 Papain family cysteine protease
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 26
Acc65I GGTACC 1 cut(s) 378
AccB1I GGYRCC 1 cut(s) 378
AclWI GGATC 1 cut(s) 89
AcoI YGGCCR 1 cut(s) 276
AcsI RAATTY 1 cut(s) 287
AcyI GRCGYC 1 cut(s) 178
AfaI GTAC 1 cut(s) 380
AfiI CCNNNNNNNGG 2 cut(s) 451, 676
AflIII ACRYGT 1 cut(s) 691
AgsI TTSAA 4 cut(s) 11, 112, 223, 314
AhlI ACTAGT 1 cut(s) 653
AluBI AGCT 2 cut(s) 317, 342
AluI AGCT 2 cut(s) 317, 342
Alw26I GTCTC 2 cut(s) 185, 682
AlwI GGATC 1 cut(s) 89
AoxI GGCC 1 cut(s) 276
ApeKI GCWGC 2 cut(s) 594, 721
ApoI RAATTY 1 cut(s) 287
Asp700I GAANNNNTTC 1 cut(s) 288
Asp718I GGTACC 1 cut(s) 378
AsuHPI GGTGA 3 cut(s) 167, 175, 319
BalI TGGCCA 1 cut(s) 278
BanI GGYRCC 1 cut(s) 378
BbvI GCAGC 2 cut(s) 581, 708
BccI CCATC 1 cut(s) 124
BceAI ACGGC 1 cut(s) 453
BcoDI GTCTC 2 cut(s) 185, 682
BcuI ACTAGT 1 cut(s) 653
BfaI CTAG 2 cut(s) 411, 654
BfmI CTRYAG 1 cut(s) 595
BisI GCNGC 2 cut(s) 595, 722
BlsI GCNGC 2 cut(s) 596, 723
BmiI GGNNCC 1 cut(s) 380
BmsI GCATC 1 cut(s) 607
BpmI CTGGAG 1 cut(s) 442
BpuEI CTTGAG 1 cut(s) 322
BsaHI GRCGYC 1 cut(s) 178
BsaJI CCNNGG 2 cut(s) 229, 349
Bsc4I CCNNNNNNNGG 2 cut(s) 451, 676
Bse1I ACTGG 2 cut(s) 310, 425
Bse3DI GCAATG 2 cut(s) 63, 131
BseDI CCNNGG 2 cut(s) 229, 349
BseGI GGATG 1 cut(s) 135
BseLI CCNNNNNNNGG 2 cut(s) 451, 676
BseMI GCAATG 2 cut(s) 63, 131
BseNI ACTGG 2 cut(s) 310, 425
BseXI GCAGC 2 cut(s) 581, 708
BseYI CCCAGC 1 cut(s) 70
BsgI GTGCAG 1 cut(s) 701
BshFI GGCC 1 cut(s) 278
BshNI GGYRCC 1 cut(s) 378
BslI CCNNNNNNNGG 2 cut(s) 451, 676
BsmAI GTCTC 2 cut(s) 185, 682
BsmBI CGTCTC 1 cut(s) 185
BsnI GGCC 1 cut(s) 278
Bsp143I GATC 2 cut(s) 94, 577
BspANI GGCC 1 cut(s) 278
BspLI GGNNCC 1 cut(s) 380
BspMAI CTGCAG 1 cut(s) 599
BspPI GGATC 1 cut(s) 89
BspT107I GGYRCC 1 cut(s) 378
BsrDI GCAATG 2 cut(s) 63, 131
BsrI ACTGG 2 cut(s) 310, 425
BssECI CCNNGG 2 cut(s) 229, 349
BssMI GATC 2 cut(s) 94, 577
BssNI GRCGYC 1 cut(s) 178
BssT1I CCWWGG 1 cut(s) 229
Bst4CI ACNGT 4 cut(s) 138, 155, 546, 569
Bst6I CTCTTC 1 cut(s) 680
BstACI GRCGYC 1 cut(s) 178
BstDEI CTNAG 1 cut(s) 704
BstDSI CCRYGG 1 cut(s) 349
BstF5I GGATG 1 cut(s) 135
BstKTI GATC 2 cut(s) 97, 580
BstMAI GTCTC 2 cut(s) 185, 682
BstMBI GATC 2 cut(s) 94, 577
BstMWI GCNNNNNNNGC 1 cut(s) 488
BstNSI RCATGY 1 cut(s) 695
BstSFI CTRYAG 1 cut(s) 595
BstV1I GCAGC 2 cut(s) 581, 708
BsuRI GGCC 1 cut(s) 278
BtgI CCRYGG 1 cut(s) 349
BtsCI GGATG 1 cut(s) 135
BtsI GCAGTG 2 cut(s) 498, 604
BtsIMutI CAGTG 4 cut(s) 303, 498, 542, 604
CseI GACGC 3 cut(s) 153, 167, 244
Csp6I GTAC 1 cut(s) 379
CviAII CATG 1 cut(s) 692
CviJI RGCY 6 cut(s) 5, 228, 278, 317, 342, 594
CviKI_1 RGCY 6 cut(s) 5, 228, 278, 317, 342, 594
CviQI GTAC 1 cut(s) 379
DdeI CTNAG 1 cut(s) 704
DpnI GATC 2 cut(s) 96, 579
DpnII GATC 2 cut(s) 94, 577
DraI TTTAAA 1 cut(s) 625
EaeI YGGCCR 1 cut(s) 276
Eam1104I CTCTTC 1 cut(s) 680
EarI CTCTTC 1 cut(s) 680
Eco130I CCWWGG 1 cut(s) 229
EcoT14I CCWWGG 1 cut(s) 229
ErhI CCWWGG 1 cut(s) 229
Esp3I CGTCTC 1 cut(s) 185
FaeI CATG 1 cut(s) 695
FaiI YATR 8 cut(s) 26, 188, 275, 611, 632, 672, 693, 719
FatI CATG 1 cut(s) 691
Fnu4HI GCNGC 2 cut(s) 595, 722
FokI GGATG 1 cut(s) 142
Fsp4HI GCNGC 2 cut(s) 595, 722
FspBI CTAG 2 cut(s) 411, 654
GluI GCNGC 2 cut(s) 595, 722
GsaI CCCAGC 1 cut(s) 74
GsuI CTGGAG 1 cut(s) 442
HaeIII GGCC 1 cut(s) 278
HgaI GACGC 3 cut(s) 153, 167, 244
Hin1I GRCGYC 1 cut(s) 178
Hin1II CATG 1 cut(s) 695
HincII GTYRAC 1 cut(s) 259
HindII GTYRAC 1 cut(s) 259
HinfI GANTC 1 cut(s) 648
HphI GGTGA 3 cut(s) 167, 175, 319
Hpy166II GTNNAC 3 cut(s) 259, 353, 565
Hpy188I TCNGA 6 cut(s) 143, 271, 296, 394, 408, 550
Hpy188III TCNNGA 1 cut(s) 193
Hpy8I GTNNAC 3 cut(s) 259, 353, 565
HpyCH4III ACNGT 4 cut(s) 138, 155, 546, 569
HpyCH4IV ACGT 2 cut(s) 77, 358
HpyCH4V TGCA 3 cut(s) 164, 597, 682
HpyF10VI GCNNNNNNNGC 1 cut(s) 488
HpyF3I CTNAG 1 cut(s) 704
HpySE526I ACGT 2 cut(s) 77, 358
Hsp92I GRCGYC 1 cut(s) 178
Hsp92II CATG 1 cut(s) 695
KpnI GGTACC 1 cut(s) 382
Kzo9I GATC 2 cut(s) 94, 577
LmnI GCTCC 1 cut(s) 322
LpnPI CCDG 4 cut(s) 84, 291, 401, 406
Lsp1109I GCAGC 2 cut(s) 581, 708
LweI GCATC 1 cut(s) 607
MaeI CTAG 2 cut(s) 411, 654
MaeII ACGT 2 cut(s) 77, 358
MaeIII GTNAC 6 cut(s) 155, 325, 439, 527, 569, 694
MalI GATC 2 cut(s) 96, 579
MboI GATC 2 cut(s) 94, 577
MboII GAAGA 5 cut(s) 208, 296, 626, 671, 697
MfeI CAATTG 2 cut(s) 501, 533
MlsI TGGCCA 1 cut(s) 278
MluCI AATT 6 cut(s) 27, 287, 414, 501, 533, 582
MluNI TGGCCA 1 cut(s) 278
MmeI TCCRAC 2 cut(s) 105, 431
MnlI CCTC 4 cut(s) 109, 417, 499, 638
Mox20I TGGCCA 1 cut(s) 278
MroXI GAANNNNTTC 1 cut(s) 288
MscI TGGCCA 1 cut(s) 278
MseI TTAA 4 cut(s) 251, 332, 585, 624
MslI CAYNNNNRTG 1 cut(s) 191
Msp20I TGGCCA 1 cut(s) 278
MunI CAATTG 2 cut(s) 501, 533
MwoI GCNNNNNNNGC 1 cut(s) 488
NdeII GATC 2 cut(s) 94, 577
NlaIII CATG 1 cut(s) 695
NlaIV GGNNCC 1 cut(s) 380
NmuCI GTSAC 3 cut(s) 155, 325, 694
NspI RCATGY 1 cut(s) 695
PciI ACATGT 1 cut(s) 691
PdmI GAANNNNTTC 1 cut(s) 288
PfeI GAWTC 1 cut(s) 648
PkrI GCNGC 2 cut(s) 596, 723
PscI ACATGT 1 cut(s) 691
PsiI TTATAA 1 cut(s) 26
PspFI CCCAGC 1 cut(s) 70
PspN4I GGNNCC 1 cut(s) 380
PstI CTGCAG 1 cut(s) 599
RsaI GTAC 1 cut(s) 380
RsaNI GTAC 1 cut(s) 379
RseI CAYNNNNRTG 1 cut(s) 191
SaqAI TTAA 4 cut(s) 251, 332, 585, 624
SatI GCNGC 2 cut(s) 595, 722
Sau3AI GATC 2 cut(s) 94, 577
SetI ASST 9 cut(s) 21, 80, 319, 332, 344, 361, 380, 390, 436
SfaNI GCATC 1 cut(s) 607
SfcI CTRYAG 1 cut(s) 595
SmiMI CAYNNNNRTG 1 cut(s) 191
SmlI CTYRAG 1 cut(s) 337
SmoI CTYRAG 1 cut(s) 337
SpeI ACTAGT 1 cut(s) 653
Sse9I AATT 6 cut(s) 27, 287, 414, 501, 533, 582
SspI AATATT 1 cut(s) 371
SspMI CTAG 2 cut(s) 411, 654
StyI CCWWGG 1 cut(s) 229
TaaI ACNGT 4 cut(s) 138, 155, 546, 569
TaiI ACGT 2 cut(s) 80, 361
TasI AATT 6 cut(s) 27, 287, 414, 501, 533, 582
TfiI GAWTC 1 cut(s) 648
Tru1I TTAA 4 cut(s) 251, 332, 585, 624
Tru9I TTAA 4 cut(s) 251, 332, 585, 624
TscAI CASTG 4 cut(s) 310, 498, 549, 604
TseFI GTSAC 3 cut(s) 155, 325, 694
TseI GCWGC 2 cut(s) 594, 721
Tsp45I GTSAC 3 cut(s) 155, 325, 694
TspDTI ATGAA 2 cut(s) 102, 297
TspGWI ACGGA 2 cut(s) 338, 657
TspRI CASTG 4 cut(s) 310, 498, 549, 604
XapI RAATTY 1 cut(s) 287
XceI RCATGY 1 cut(s) 695
XmnI GAANNNNTTC 1 cut(s) 288
XspI CTAG 2 cut(s) 411, 654
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.