Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002266.1

Orthogroup ID

OG0004772

Physical Location & Seq

Genomic Coordinates Reverse (-)

62733 .. 65915

Gene Structure 3183 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002266.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 813 bp

atggcgatggagtccaacaccgggtttctacatgatgagacttttggctatggcttgaaccgccacgctatatctttccagtctggagcaataaacagcagctcggagatgattccgatggggaattactttggtactgacccggtgatggggatggggatggggttggggatgatgttctctccgacttccgggtcagccatgggcatgggcatggtcaaccacagtcctgtaattagtcaacccgggacttcatcaggggcttctctgctcgttgattcggtaccgggcctcaagcatgacacaggcttggcagttgagtggtctatggaggagcagtacaaattggaggagggccttgtcaaatttgctgatgaaccaagtactatgagatatgctgatgaaccaagtattatgaggtacataaagattgcggcaaccttgcgtgataaaactgtgcgtgatgttgccttgaggtgtaggtggatgacgagaaagcggaggaaacctgaagaccatactacaggaaagaagggcaacattaggaaggataaactggtagattcataccccaagatgagcataccctcagctccacaacacaacatggctgcatattctcttatgatgcatcgtatgaaccagaatgagcgtttgcagtgtgaaggaataagtgggacagccaagcatttattggaccaaaatgctcaagcttttaatcaaatcacagctaacctttctacgtacaaggtcagtgacttgttgtacatgttgaatattttgaatctaatttccctgtcattgctcctctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF3755

Protein Analysis

270

Amino Acids

29.9

Weight (kDa)

7.8

Isoelectric Point (pI)

42.58

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004772)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G10820 AT1G10820 AT1G60670 AT1G60670 AT1G60670 AT1G60670 AT1G60670 AT1G68160
fragaria_vesca	FvH4_4g36480 FvH4_4g36480
malus_domestica	MD13G1008900.v1.1 MD16G1006900.v1.1
prunus_persica	Prupe.1G343800_v2.0.a1 Prupe.1G343800_v2.0.a1 Prupe.1G343800_v2.0.a1
pyrus_communis	pycom13g00750
rosa_chinensis	RchiOBHm_Chr4g0446241
rosa_laevigata	RLG00000005678
rosa_multiflora	Rmu_sc0002266.1_g000010 Rmu_sc0014728.1_g000006
rosa_roxburghii	Rroxscaffold_5G00386640
rosa_rugosa	Rorug04G0368500 Rorug04G0368600 Rorug04G0368600 Rorug04G0368700 Rorug04G0368800
rosa_samantha	Rh4AG430900 Rh4BG440300 Rh4CG457600 Rh4DG438800
rosa_wichuraiana	Rw4G036810

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	193
Acc65I	GGTACC	1 cut(s)	283
AccB1I	GGYRCC	1 cut(s)	283
AciI	CCGC	3 cut(s)	61, 434, 499
AcsI	RAATTY	1 cut(s)	365
AcuI	CTGAAG	1 cut(s)	531
AfaI	GTAC	7 cut(s)	136, 285, 341, 385, 422, 746, 767
AfiI	CCNNNNNNNGG	4 cut(s)	21, 148, 149, 191
AflIII	ACRYGT	1 cut(s)	768
AgsI	TTSAA	3 cut(s)	58, 775, 784
AluBI	AGCT	4 cut(s)	102, 593, 713, 731
AluI	AGCT	4 cut(s)	102, 593, 713, 731
Alw26I	GTCTC	1 cut(s)	32
Ama87I	CYCGRG	1 cut(s)	245
AoxI	GGCC	2 cut(s)	289, 355
ApeKI	GCWGC	2 cut(s)	99, 611
ApoI	RAATTY	1 cut(s)	365
Asp718I	GGTACC	1 cut(s)	283
AspS9I	GGNCC	3 cut(s)	289, 355, 697
AsuC2I	CCSGG	6 cut(s)	22, 143, 193, 246, 247, 288
AsuHPI	GGTGA	1 cut(s)	157
AvaI	CYCGRG	1 cut(s)	245
AvaII	GGWCC	1 cut(s)	697
BanI	GGYRCC	1 cut(s)	283
BbsI	GAAGAC	1 cut(s)	519
BbvCI	CCTCAGC	1 cut(s)	589
BbvI	GCAGC	2 cut(s)	111, 598
BccI	CCATC	4 cut(s)	112, 142, 148, 154
BcnI	CCSGG	6 cut(s)	22, 143, 193, 246, 247, 288
BcoDI	GTCTC	1 cut(s)	32
BfmI	CTRYAG	1 cut(s)	522
BisI	GCNGC	3 cut(s)	100, 435, 612
BlsI	GCNGC	3 cut(s)	101, 436, 613
BmcAI	AGTACT	1 cut(s)	385
Bme1390I	CCNGG	6 cut(s)	22, 143, 193, 246, 247, 288
Bme18I	GGWCC	1 cut(s)	697
BmeT110I	CYCGRG	1 cut(s)	245
BmgT120I	GGNCC	3 cut(s)	289, 355, 697
BmiI	GGNNCC	1 cut(s)	285
BmrFI	CCNGG	6 cut(s)	22, 143, 193, 246, 247, 288
BmsI	GCATC	2 cut(s)	618, 640
BpiI	GAAGAC	1 cut(s)	519
BpmI	CTGGAG	1 cut(s)	105
Bpu10I	CCTNAGC	1 cut(s)	589
BpuEI	CTTGAG	3 cut(s)	278, 493, 693
BpuMI	CCSGG	6 cut(s)	22, 143, 193, 246, 247, 288
BsaAI	YACGTR	1 cut(s)	744
BsaJI	CCNNGG	2 cut(s)	201, 245
BsaXI	ACNNNNNCTCC	2 cut(s)	323, 353
Bsc4I	CCNNNNNNNGG	4 cut(s)	21, 148, 149, 191
Bse1I	ACTGG	2 cut(s)	79, 561
Bse3DI	GCAATG	1 cut(s)	800
BseDI	CCNNGG	2 cut(s)	201, 245
BseGI	GGATG	4 cut(s)	159, 165, 177, 492
BseLI	CCNNNNNNNGG	4 cut(s)	21, 148, 149, 191
BseMI	GCAATG	1 cut(s)	800
BseMII	CTCAG	1 cut(s)	603
BseNI	ACTGG	2 cut(s)	79, 561
BseRI	GAGGAG	3 cut(s)	347, 365, 797
BseXI	GCAGC	2 cut(s)	111, 598
BshFI	GGCC	2 cut(s)	291, 357
BshNI	GGYRCC	1 cut(s)	283
BsiHKCI	CYCGRG	1 cut(s)	245
BsiSI	CCGG	5 cut(s)	21, 143, 192, 246, 287
BslFI	GGGAC	2 cut(s)	262, 691
BslI	CCNNNNNNNGG	4 cut(s)	21, 148, 149, 191
BsmAI	GTCTC	1 cut(s)	32
BsmFI	GGGAC	2 cut(s)	262, 691
BsnI	GGCC	2 cut(s)	291, 357
BsoBI	CYCGRG	1 cut(s)	245
Bsp1407I	TGTACA	1 cut(s)	765
Bsp19I	CCATGG	1 cut(s)	201
BspACI	CCGC	3 cut(s)	61, 434, 499
BspANI	GGCC	2 cut(s)	291, 357
BspCNI	CTCAG	1 cut(s)	602
BspLI	GGNNCC	1 cut(s)	285
BspT107I	GGYRCC	1 cut(s)	283
BsrDI	GCAATG	1 cut(s)	800
BsrGI	TGTACA	1 cut(s)	765
BsrI	ACTGG	2 cut(s)	79, 561
BssECI	CCNNGG	2 cut(s)	201, 245
BssT1I	CCWWGG	1 cut(s)	201
Bst4CI	ACNGT	2 cut(s)	227, 457
BstAUI	TGTACA	1 cut(s)	765
BstBAI	YACGTR	1 cut(s)	744
BstDEI	CTNAG	1 cut(s)	589
BstDSI	CCRYGG	1 cut(s)	201
BstF5I	GGATG	4 cut(s)	159, 165, 177, 492
BstMAI	GTCTC	1 cut(s)	32
BstMWI	GCNNNNNNNGC	1 cut(s)	60
BstNSI	RCATGY	1 cut(s)	772
BstSCI	CCNGG	6 cut(s)	20, 141, 191, 244, 245, 286
BstSFI	CTRYAG	1 cut(s)	522
BstSNI	TACGTA	1 cut(s)	744
BstV1I	GCAGC	2 cut(s)	111, 598
BstV2I	GAAGAC	1 cut(s)	519
BstXI	CCANNNNNNTGG	1 cut(s)	208
BsuRI	GGCC	2 cut(s)	291, 357
BtgI	CCRYGG	1 cut(s)	201
BtgZI	GCGATG	1 cut(s)	20
BtsCI	GGATG	4 cut(s)	159, 165, 177, 492
BtsI	GCAGTG	1 cut(s)	665
BtsIMutI	CAGTG	2 cut(s)	665, 760
Cfr13I	GGNCC	3 cut(s)	289, 355, 697
Cfr9I	CCCGGG	1 cut(s)	245
Csp6I	GTAC	7 cut(s)	135, 284, 340, 384, 421, 745, 766
CviAII	CATG	7 cut(s)	32, 202, 208, 214, 299, 607, 769
CviQI	GTAC	7 cut(s)	135, 284, 340, 384, 421, 745, 766
DdeI	CTNAG	1 cut(s)	589
DrdI	GACNNNNNNGTC	1 cut(s)	193
DseDI	GACNNNNNNGTC	1 cut(s)	193
Eco105I	TACGTA	1 cut(s)	744
Eco130I	CCWWGG	1 cut(s)	201
Eco47I	GGWCC	1 cut(s)	697
Eco57I	CTGAAG	1 cut(s)	531
Eco88I	CYCGRG	1 cut(s)	245
EcoO109I	RGGNCCY	1 cut(s)	355
EcoT14I	CCWWGG	1 cut(s)	201
EcoT22I	ATGCAT	1 cut(s)	633
ErhI	CCWWGG	1 cut(s)	201
FaeI	CATG	7 cut(s)	35, 205, 211, 217, 302, 610, 772
FaqI	GGGAC	2 cut(s)	262, 691
FatI	CATG	7 cut(s)	31, 201, 207, 213, 298, 606, 768
Fnu4HI	GCNGC	3 cut(s)	100, 435, 612
FokI	GGATG	4 cut(s)	166, 172, 184, 499
Fsp4HI	GCNGC	3 cut(s)	100, 435, 612
GluI	GCNGC	3 cut(s)	100, 435, 612
GsuI	CTGGAG	1 cut(s)	105
HaeIII	GGCC	2 cut(s)	291, 357
HapII	CCGG	5 cut(s)	21, 143, 192, 246, 287
Hin1II	CATG	7 cut(s)	35, 205, 211, 217, 302, 610, 772
HincII	GTYRAC	2 cut(s)	220, 242
HindII	GTYRAC	2 cut(s)	220, 242
HindIII	AAGCTT	1 cut(s)	711
HinfI	GANTC	5 cut(s)	11, 112, 278, 563, 784
HpaII	CCGG	5 cut(s)	21, 143, 192, 246, 287
HphI	GGTGA	1 cut(s)	157
Hpy166II	GTNNAC	2 cut(s)	220, 242
Hpy188I	TCNGA	3 cut(s)	106, 117, 186
Hpy188III	TCNNGA	1 cut(s)	84
Hpy8I	GTNNAC	2 cut(s)	220, 242
HpyAV	CCTTC	3 cut(s)	526, 541, 659
HpyCH4III	ACNGT	2 cut(s)	227, 457
HpyCH4IV	ACGT	1 cut(s)	743
HpyCH4V	TGCA	3 cut(s)	614, 631, 658
HpyF10VI	GCNNNNNNNGC	1 cut(s)	60
HpyF3I	CTNAG	1 cut(s)	589
HpySE526I	ACGT	1 cut(s)	743
Hsp92II	CATG	7 cut(s)	35, 205, 211, 217, 302, 610, 772
KpnI	GGTACC	1 cut(s)	287
LmnI	GCTCC	4 cut(s)	86, 334, 598, 810
Lsp1109I	GCAGC	2 cut(s)	111, 598
LweI	GCATC	2 cut(s)	618, 640
MaeII	ACGT	1 cut(s)	743
MaeIII	GTNAC	1 cut(s)	755
MboII	GAAGA	1 cut(s)	524
MluCI	AATT	5 cut(s)	124, 234, 344, 365, 789
MlyI	GAGTC	1 cut(s)	20
MmeI	TCCRAC	2 cut(s)	39, 209
MnlI	CCTC	8 cut(s)	302, 325, 343, 346, 411, 468, 495, 598
Mph1103I	ATGCAT	1 cut(s)	633
MseI	TTAA	1 cut(s)	717
MslI	CAYNNNNRTG	2 cut(s)	206, 212
MspI	CCGG	5 cut(s)	21, 143, 192, 246, 287
MspR9I	CCNGG	6 cut(s)	22, 143, 193, 246, 247, 288
MwoI	GCNNNNNNNGC	1 cut(s)	60
NciI	CCSGG	6 cut(s)	22, 143, 193, 246, 247, 288
NcoI	CCATGG	1 cut(s)	201
NlaIII	CATG	7 cut(s)	35, 205, 211, 217, 302, 610, 772
NlaIV	GGNNCC	1 cut(s)	285
NmuCI	GTSAC	1 cut(s)	755
NsiI	ATGCAT	1 cut(s)	633
NspI	RCATGY	1 cut(s)	772
PciI	ACATGT	1 cut(s)	768
PfeI	GAWTC	4 cut(s)	112, 278, 563, 784
PkrI	GCNGC	3 cut(s)	101, 436, 613
PleI	GAGTC	1 cut(s)	19
PpsI	GAGTC	1 cut(s)	19
Ppu21I	YACGTR	1 cut(s)	744
PscI	ACATGT	1 cut(s)	768
PspN4I	GGNNCC	1 cut(s)	285
PspPI	GGNCC	3 cut(s)	289, 355, 697
RsaI	GTAC	7 cut(s)	136, 285, 341, 385, 422, 746, 767
RsaNI	GTAC	7 cut(s)	135, 284, 340, 384, 421, 745, 766
RseI	CAYNNNNRTG	2 cut(s)	206, 212
SaqAI	TTAA	1 cut(s)	717
SatI	GCNGC	3 cut(s)	100, 435, 612
Sau96I	GGNCC	3 cut(s)	289, 355, 697
ScaI	AGTACT	1 cut(s)	385
SchI	GAGTC	1 cut(s)	20
ScrFI	CCNGG	6 cut(s)	22, 143, 193, 246, 247, 288
SfaNI	GCATC	2 cut(s)	618, 640
SfcI	CTRYAG	1 cut(s)	522
SinI	GGWCC	1 cut(s)	697
SmaI	CCCGGG	1 cut(s)	247
SmiMI	CAYNNNNRTG	2 cut(s)	206, 212
SmlI	CTYRAG	3 cut(s)	293, 472, 708
SmoI	CTYRAG	3 cut(s)	293, 472, 708
SnaBI	TACGTA	1 cut(s)	744
Sse9I	AATT	5 cut(s)	124, 234, 344, 365, 789
SsiI	CCGC	3 cut(s)	61, 434, 499
SspI	AATATT	1 cut(s)	778
StyD4I	CCNGG	6 cut(s)	20, 141, 191, 244, 245, 286
StyI	CCWWGG	1 cut(s)	201
TaaI	ACNGT	2 cut(s)	227, 457
TaiI	ACGT	1 cut(s)	746
TasI	AATT	5 cut(s)	124, 234, 344, 365, 789
TatI	WGTACW	3 cut(s)	339, 383, 765
TauI	GCSGC	1 cut(s)	437
TfiI	GAWTC	4 cut(s)	112, 278, 563, 784
Tru1I	TTAA	1 cut(s)	717
Tru9I	TTAA	1 cut(s)	717
TscAI	CASTG	2 cut(s)	665, 760
TseFI	GTSAC	1 cut(s)	755
TseI	GCWGC	2 cut(s)	99, 611
Tsp45I	GTSAC	1 cut(s)	755
TspDTI	ATGAA	5 cut(s)	243, 390, 417, 555, 653
TspMI	CCCGGG	1 cut(s)	245
TspRI	CASTG	2 cut(s)	665, 760
VpaK11BI	GGWCC	1 cut(s)	697
XapI	RAATTY	1 cut(s)	365
XceI	RCATGY	1 cut(s)	772
XcmI	CCANNNNNNNNNTGG	1 cut(s)	691
XmaI	CCCGGG	1 cut(s)	245
ZrmI	AGTACT	1 cut(s)	385
Zsp2I	ATGCAT	1 cut(s)	633

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.