Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0014728.1

Orthogroup ID

OG0004772

Physical Location & Seq

Genomic Coordinates Reverse (-)

9895 .. 13580

Gene Structure 3686 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0014728.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 885 bp

atggcgatggagtccaacaccgggtttctacatgatgagacttttggctatggcttgaaccgccacgctatatctttccagtctggagcaataaacagcagctcggagatgattccgatggggaattactttggtactgacccggtgatggggatggggatggggttggggatgatgttctctccgacttccgggtcagccatgggcatgggcatggtcaaccacagtcctgtaattagtcaacccgggacttcatcaggggcttctctgctcgttgattcggtaccgggcctcaagcatgacacaggcttggcagttgagtggtctatggaggagcagtacaaattggaggagggccttgtcaaatatgctgatgaaccgagtattatgaggtacataaagattgcggcaaccttgcgtgataaaactgtgcgtgatgttgccttgaggtgtaggtggatgacgagaaagcggaggaaacctgaagaccatactacaggaaagaagggcaacattaggaaggataaactggtagattcatactccaagatgagcataccctcagctccacaacacaacatggctgcatattctcttatgatgcatcgtatgaaccagaatgagcgtttgcagtgtgaaggaataagtgggacagccaagcatttattggaccaaaatgctcaagcttttaatcaaatcacagctaacctttctacgtacaagttacaggacaatattaacctcttctgtcgcacaaggaacaacttaactgccatcttgaatgacatgagaggtatgcctggcttaatgagccaaatgccgccgctggatgtatgcataaatgagaaccttgctaatagtgttatcttgcctaatacaacttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF3755

Protein Analysis

294

Amino Acids

32.5

Weight (kDa)

8.3

Isoelectric Point (pI)

45.95

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004772)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G10820 AT1G10820 AT1G60670 AT1G60670 AT1G60670 AT1G60670 AT1G60670 AT1G68160
fragaria_vesca	FvH4_4g36480 FvH4_4g36480
malus_domestica	MD13G1008900.v1.1 MD16G1006900.v1.1
prunus_persica	Prupe.1G343800_v2.0.a1 Prupe.1G343800_v2.0.a1 Prupe.1G343800_v2.0.a1
pyrus_communis	pycom13g00750
rosa_chinensis	RchiOBHm_Chr4g0446241
rosa_laevigata	RLG00000005678
rosa_multiflora	Rmu_sc0002266.1_g000010 Rmu_sc0014728.1_g000006
rosa_roxburghii	Rroxscaffold_5G00386640
rosa_rugosa	Rorug04G0368500 Rorug04G0368600 Rorug04G0368600 Rorug04G0368700 Rorug04G0368800
rosa_samantha	Rh4AG430900 Rh4BG440300 Rh4CG457600 Rh4DG438800
rosa_wichuraiana	Rw4G036810

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	193
Acc65I	GGTACC	1 cut(s)	283
AccB1I	GGYRCC	1 cut(s)	283
AciI	CCGC	5 cut(s)	61, 407, 472, 821, 824
AcuI	CTGAAG	1 cut(s)	504
AfaI	GTAC	5 cut(s)	136, 285, 341, 395, 719
AfiI	CCNNNNNNNGG	4 cut(s)	21, 148, 149, 191
AgsI	TTSAA	2 cut(s)	58, 781
AjnI	CCWGG	1 cut(s)	799
AluBI	AGCT	4 cut(s)	102, 566, 686, 704
AluI	AGCT	4 cut(s)	102, 566, 686, 704
Alw26I	GTCTC	1 cut(s)	32
Ama87I	CYCGRG	1 cut(s)	245
AoxI	GGCC	2 cut(s)	289, 355
ApeKI	GCWGC	2 cut(s)	99, 584
Asp718I	GGTACC	1 cut(s)	283
AspS9I	GGNCC	3 cut(s)	289, 355, 670
AsuC2I	CCSGG	6 cut(s)	22, 143, 193, 246, 247, 288
AsuHPI	GGTGA	1 cut(s)	157
AvaI	CYCGRG	1 cut(s)	245
AvaII	GGWCC	1 cut(s)	670
BanI	GGYRCC	1 cut(s)	283
BbsI	GAAGAC	1 cut(s)	492
BbvCI	CCTCAGC	1 cut(s)	562
BbvI	GCAGC	2 cut(s)	111, 571
BccI	CCATC	5 cut(s)	112, 142, 148, 154, 782
BciT130I	CCWGG	1 cut(s)	801
BcnI	CCSGG	6 cut(s)	22, 143, 193, 246, 247, 288
BcoDI	GTCTC	1 cut(s)	32
BfmI	CTRYAG	1 cut(s)	495
BisI	GCNGC	5 cut(s)	100, 408, 585, 821, 824
BlsI	GCNGC	5 cut(s)	101, 409, 586, 822, 825
Bme1390I	CCNGG	7 cut(s)	22, 143, 193, 246, 247, 288, 801
Bme18I	GGWCC	1 cut(s)	670
BmeT110I	CYCGRG	1 cut(s)	245
BmgT120I	GGNCC	3 cut(s)	289, 355, 670
BmiI	GGNNCC	1 cut(s)	285
BmrFI	CCNGG	7 cut(s)	22, 143, 193, 246, 247, 288, 801
BmsI	GCATC	2 cut(s)	591, 613
BpiI	GAAGAC	1 cut(s)	492
BpmI	CTGGAG	1 cut(s)	105
Bpu10I	CCTNAGC	1 cut(s)	562
BpuEI	CTTGAG	3 cut(s)	278, 466, 666
BpuMI	CCSGG	6 cut(s)	22, 143, 193, 246, 247, 288
BsaAI	YACGTR	1 cut(s)	717
BsaJI	CCNNGG	2 cut(s)	201, 245
BsaXI	ACNNNNNCTCC	2 cut(s)	323, 353
Bsc4I	CCNNNNNNNGG	4 cut(s)	21, 148, 149, 191
Bse1I	ACTGG	2 cut(s)	79, 534
BseBI	CCWGG	1 cut(s)	801
BseDI	CCNNGG	2 cut(s)	201, 245
BseGI	GGATG	5 cut(s)	159, 165, 177, 465, 835
BseLI	CCNNNNNNNGG	4 cut(s)	21, 148, 149, 191
BseMII	CTCAG	1 cut(s)	576
BseNI	ACTGG	2 cut(s)	79, 534
BseRI	GAGGAG	2 cut(s)	347, 365
BseXI	GCAGC	2 cut(s)	111, 571
BshFI	GGCC	2 cut(s)	291, 357
BshNI	GGYRCC	1 cut(s)	283
BsiHKCI	CYCGRG	1 cut(s)	245
BsiSI	CCGG	5 cut(s)	21, 143, 192, 246, 287
BslFI	GGGAC	2 cut(s)	262, 664
BslI	CCNNNNNNNGG	4 cut(s)	21, 148, 149, 191
BsmAI	GTCTC	1 cut(s)	32
BsmFI	GGGAC	2 cut(s)	262, 664
BsnI	GGCC	2 cut(s)	291, 357
BsoBI	CYCGRG	1 cut(s)	245
Bsp19I	CCATGG	1 cut(s)	201
BspACI	CCGC	5 cut(s)	61, 407, 472, 821, 824
BspANI	GGCC	2 cut(s)	291, 357
BspCNI	CTCAG	1 cut(s)	575
BspLI	GGNNCC	1 cut(s)	285
BspT107I	GGYRCC	1 cut(s)	283
BsrI	ACTGG	2 cut(s)	79, 534
BssECI	CCNNGG	2 cut(s)	201, 245
BssT1I	CCWWGG	1 cut(s)	201
Bst2UI	CCWGG	1 cut(s)	801
Bst4CI	ACNGT	2 cut(s)	227, 430
Bst6I	CTCTTC	1 cut(s)	749
BstBAI	YACGTR	1 cut(s)	717
BstDEI	CTNAG	2 cut(s)	562, 882
BstDSI	CCRYGG	1 cut(s)	201
BstF5I	GGATG	5 cut(s)	159, 165, 177, 465, 835
BstMAI	GTCTC	1 cut(s)	32
BstMWI	GCNNNNNNNGC	2 cut(s)	60, 810
BstNI	CCWGG	1 cut(s)	801
BstSCI	CCNGG	7 cut(s)	20, 141, 191, 244, 245, 286, 799
BstSFI	CTRYAG	1 cut(s)	495
BstSNI	TACGTA	1 cut(s)	717
BstV1I	GCAGC	2 cut(s)	111, 571
BstV2I	GAAGAC	1 cut(s)	492
BstXI	CCANNNNNNTGG	1 cut(s)	208
BsuRI	GGCC	2 cut(s)	291, 357
BtgI	CCRYGG	1 cut(s)	201
BtgZI	GCGATG	1 cut(s)	20
BtsCI	GGATG	5 cut(s)	159, 165, 177, 465, 835
BtsI	GCAGTG	1 cut(s)	638
BtsIMutI	CAGTG	1 cut(s)	638
Cfr13I	GGNCC	3 cut(s)	289, 355, 670
Cfr9I	CCCGGG	1 cut(s)	245
Csp6I	GTAC	5 cut(s)	135, 284, 340, 394, 718
CviAII	CATG	7 cut(s)	32, 202, 208, 214, 299, 580, 787
CviQI	GTAC	5 cut(s)	135, 284, 340, 394, 718
DdeI	CTNAG	2 cut(s)	562, 882
DrdI	GACNNNNNNGTC	1 cut(s)	193
DseDI	GACNNNNNNGTC	1 cut(s)	193
Eam1104I	CTCTTC	1 cut(s)	749
EarI	CTCTTC	1 cut(s)	749
Eco105I	TACGTA	1 cut(s)	717
Eco130I	CCWWGG	1 cut(s)	201
Eco47I	GGWCC	1 cut(s)	670
Eco57I	CTGAAG	1 cut(s)	504
Eco88I	CYCGRG	1 cut(s)	245
EcoO109I	RGGNCCY	1 cut(s)	355
EcoRII	CCWGG	1 cut(s)	799
EcoT14I	CCWWGG	1 cut(s)	201
EcoT22I	ATGCAT	2 cut(s)	606, 839
ErhI	CCWWGG	1 cut(s)	201
FaeI	CATG	7 cut(s)	35, 205, 211, 217, 302, 583, 790
FaqI	GGGAC	2 cut(s)	262, 664
FatI	CATG	7 cut(s)	31, 201, 207, 213, 298, 579, 786
Fnu4HI	GCNGC	5 cut(s)	100, 408, 585, 821, 824
FokI	GGATG	5 cut(s)	166, 172, 184, 472, 842
Fsp4HI	GCNGC	5 cut(s)	100, 408, 585, 821, 824
GluI	GCNGC	5 cut(s)	100, 408, 585, 821, 824
GsuI	CTGGAG	1 cut(s)	105
HaeIII	GGCC	2 cut(s)	291, 357
HapII	CCGG	5 cut(s)	21, 143, 192, 246, 287
Hin1II	CATG	7 cut(s)	35, 205, 211, 217, 302, 583, 790
HincII	GTYRAC	2 cut(s)	220, 242
HindII	GTYRAC	2 cut(s)	220, 242
HindIII	AAGCTT	1 cut(s)	684
HinfI	GANTC	4 cut(s)	11, 112, 278, 536
HpaII	CCGG	5 cut(s)	21, 143, 192, 246, 287
HphI	GGTGA	1 cut(s)	157
Hpy166II	GTNNAC	2 cut(s)	220, 242
Hpy188I	TCNGA	3 cut(s)	106, 117, 186
Hpy188III	TCNNGA	2 cut(s)	84, 778
Hpy8I	GTNNAC	2 cut(s)	220, 242
HpyAV	CCTTC	3 cut(s)	499, 514, 632
HpyCH4III	ACNGT	2 cut(s)	227, 430
HpyCH4IV	ACGT	1 cut(s)	716
HpyCH4V	TGCA	4 cut(s)	587, 604, 631, 837
HpyF10VI	GCNNNNNNNGC	2 cut(s)	60, 810
HpyF3I	CTNAG	2 cut(s)	562, 882
HpySE526I	ACGT	1 cut(s)	716
Hsp92II	CATG	7 cut(s)	35, 205, 211, 217, 302, 583, 790
KpnI	GGTACC	1 cut(s)	287
LmnI	GCTCC	3 cut(s)	86, 334, 571
Lsp1109I	GCAGC	2 cut(s)	111, 571
LweI	GCATC	2 cut(s)	591, 613
MaeII	ACGT	1 cut(s)	716
MaeIII	GTNAC	1 cut(s)	723
MboII	GAAGA	2 cut(s)	497, 736
MluCI	AATT	3 cut(s)	124, 234, 344
MlyI	GAGTC	1 cut(s)	20
MmeI	TCCRAC	2 cut(s)	39, 209
Mph1103I	ATGCAT	2 cut(s)	606, 839
MseI	TTAA	4 cut(s)	690, 738, 767, 806
MslI	CAYNNNNRTG	2 cut(s)	206, 212
MspA1I	CMGCKG	1 cut(s)	826
MspI	CCGG	5 cut(s)	21, 143, 192, 246, 287
MspR9I	CCNGG	7 cut(s)	22, 143, 193, 246, 247, 288, 801
MvaI	CCWGG	1 cut(s)	801
MwoI	GCNNNNNNNGC	2 cut(s)	60, 810
NciI	CCSGG	6 cut(s)	22, 143, 193, 246, 247, 288
NcoI	CCATGG	1 cut(s)	201
NlaIII	CATG	7 cut(s)	35, 205, 211, 217, 302, 583, 790
NlaIV	GGNNCC	1 cut(s)	285
NsiI	ATGCAT	2 cut(s)	606, 839
PfeI	GAWTC	3 cut(s)	112, 278, 536
PkrI	GCNGC	5 cut(s)	101, 409, 586, 822, 825
PleI	GAGTC	1 cut(s)	19
PpsI	GAGTC	1 cut(s)	19
Ppu21I	YACGTR	1 cut(s)	717
Psp6I	CCWGG	1 cut(s)	799
PspGI	CCWGG	1 cut(s)	799
PspN4I	GGNNCC	1 cut(s)	285
PspPI	GGNCC	3 cut(s)	289, 355, 670
RsaI	GTAC	5 cut(s)	136, 285, 341, 395, 719
RsaNI	GTAC	5 cut(s)	135, 284, 340, 394, 718
RseI	CAYNNNNRTG	2 cut(s)	206, 212
SaqAI	TTAA	4 cut(s)	690, 738, 767, 806
SatI	GCNGC	5 cut(s)	100, 408, 585, 821, 824
Sau96I	GGNCC	3 cut(s)	289, 355, 670
SchI	GAGTC	1 cut(s)	20
ScrFI	CCNGG	7 cut(s)	22, 143, 193, 246, 247, 288, 801
SfaNI	GCATC	2 cut(s)	591, 613
SfcI	CTRYAG	1 cut(s)	495
SinI	GGWCC	1 cut(s)	670
SmaI	CCCGGG	1 cut(s)	247
SmiMI	CAYNNNNRTG	2 cut(s)	206, 212
SmlI	CTYRAG	3 cut(s)	293, 445, 681
SmoI	CTYRAG	3 cut(s)	293, 445, 681
SnaBI	TACGTA	1 cut(s)	717
Sse9I	AATT	3 cut(s)	124, 234, 344
SsiI	CCGC	5 cut(s)	61, 407, 472, 821, 824
SspI	AATATT	1 cut(s)	736
StyD4I	CCNGG	7 cut(s)	20, 141, 191, 244, 245, 286, 799
StyI	CCWWGG	1 cut(s)	201
TaaI	ACNGT	2 cut(s)	227, 430
TaiI	ACGT	1 cut(s)	719
TasI	AATT	3 cut(s)	124, 234, 344
TatI	WGTACW	1 cut(s)	339
TauI	GCSGC	3 cut(s)	410, 823, 826
TfiI	GAWTC	3 cut(s)	112, 278, 536
Tru1I	TTAA	4 cut(s)	690, 738, 767, 806
Tru9I	TTAA	4 cut(s)	690, 738, 767, 806
TscAI	CASTG	1 cut(s)	638
TseI	GCWGC	2 cut(s)	99, 584
TspDTI	ATGAA	4 cut(s)	243, 390, 528, 626
TspMI	CCCGGG	1 cut(s)	245
TspRI	CASTG	1 cut(s)	638
VpaK11BI	GGWCC	1 cut(s)	670
XcmI	CCANNNNNNNNNTGG	1 cut(s)	664
XmaI	CCCGGG	1 cut(s)	245
Zsp2I	ATGCAT	2 cut(s)	606, 839

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.