Rmu_sc0002289.1_g000015

4-diphosphocytidyl-2-C-methyl-D-erythritol kinase, chloroplastic

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002289.1
Physical Location & Seq
Reverse (-)
98855 .. 99576
722 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002289.1_g000015.1.cds

Sequence Viewer

Length: 366 bp
atggtttctgccaacagaaaacaagtagagatagtatacgatcctgatgaaaggataaacaagttggcagataaggtggaaaatgaggctccgccgctttcaaggctgtcactgttctcgccttgcaagattaatgttttcttgagaataactaacaaaagagaagatgggtttcatgacttggcatctctctttcatgtcataagccttggagatgtgattaagttctctttgtcaccctcaaaatccaaagatcgtttgtcgaccaatgtgtcaggggttccccttgatgataggaatttgattatcaaggcccttaatctctacaggaacaagactggtaccgacaatttcttttgggtatga

Protein Analysis

121

Amino Acids

13.76

Weight (kDa)

9.13

Isoelectric Point (pI)

27.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 271
Acc65I GGTACC 1 cut(s) 341
AccB1I GGYRCC 1 cut(s) 341
AccI GTMKAC 2 cut(s) 36, 263
AciI CCGC 2 cut(s) 92, 95
AclWI GGATC 1 cut(s) 35
AcsI RAATTY 1 cut(s) 298
AfaI GTAC 1 cut(s) 343
AgsI TTSAA 1 cut(s) 102
AlwI GGATC 1 cut(s) 35
AoxI GGCC 1 cut(s) 312
ApoI RAATTY 1 cut(s) 298
AseI ATTAAT 1 cut(s) 132
Asp718I GGTACC 1 cut(s) 341
AspS9I GGNCC 1 cut(s) 313
AsuHPI GGTGA 1 cut(s) 228
BanI GGYRCC 1 cut(s) 341
BccI CCATC 1 cut(s) 161
BfmI CTRYAG 1 cut(s) 325
BisI GCNGC 1 cut(s) 95
BlsI GCNGC 1 cut(s) 96
BmgT120I GGNCC 1 cut(s) 313
BmiI GGNNCC 3 cut(s) 90, 282, 343
BmsI GCATC 1 cut(s) 194
BpuEI CTTGAG 1 cut(s) 163
BsaJI CCNNGG 1 cut(s) 208
Bse1I ACTGG 1 cut(s) 343
BseDI CCNNGG 1 cut(s) 208
BseNI ACTGG 1 cut(s) 343
BshFI GGCC 1 cut(s) 314
BshNI GGYRCC 1 cut(s) 341
BsnI GGCC 1 cut(s) 314
Bsp143I GATC 2 cut(s) 40, 253
BspACI CCGC 2 cut(s) 92, 95
BspANI GGCC 1 cut(s) 314
BspHI TCATGA 1 cut(s) 175
BspLI GGNNCC 3 cut(s) 90, 282, 343
BspPI GGATC 1 cut(s) 35
BspT107I GGYRCC 1 cut(s) 341
BsrI ACTGG 1 cut(s) 343
BssECI CCNNGG 1 cut(s) 208
BssMI GATC 2 cut(s) 40, 253
BssNAI GTATAC 1 cut(s) 37
BssT1I CCWWGG 1 cut(s) 208
Bst1107I GTATAC 1 cut(s) 37
Bst4CI ACNGT 1 cut(s) 114
BstKTI GATC 2 cut(s) 43, 256
BstMBI GATC 2 cut(s) 40, 253
BstMWI GCNNNNNNNGC 1 cut(s) 103
BstSFI CTRYAG 1 cut(s) 325
BstZ17I GTATAC 1 cut(s) 37
BsuRI GGCC 1 cut(s) 314
BtsIMutI CAGTG 1 cut(s) 110
CciI TCATGA 1 cut(s) 175
Cfr13I GGNCC 1 cut(s) 313
Csp6I GTAC 1 cut(s) 342
CviAII CATG 2 cut(s) 176, 197
CviJI RGCY 4 cut(s) 89, 106, 207, 314
CviKI_1 RGCY 4 cut(s) 89, 106, 207, 314
CviQI GTAC 1 cut(s) 342
DpnI GATC 2 cut(s) 42, 255
DpnII GATC 2 cut(s) 40, 253
DrdI GACNNNNNNGTC 1 cut(s) 271
DseDI GACNNNNNNGTC 1 cut(s) 271
EciI GGCGGA 1 cut(s) 81
Eco130I CCWWGG 1 cut(s) 208
EcoO109I RGGNCCY 1 cut(s) 313
EcoT14I CCWWGG 1 cut(s) 208
ErhI CCWWGG 1 cut(s) 208
FaeI CATG 2 cut(s) 179, 200
FaiI YATR 5 cut(s) 37, 177, 198, 203, 364
FatI CATG 2 cut(s) 175, 196
FblI GTMKAC 2 cut(s) 36, 263
Fnu4HI GCNGC 1 cut(s) 95
Fsp4HI GCNGC 1 cut(s) 95
GluI GCNGC 1 cut(s) 95
HaeIII GGCC 1 cut(s) 314
Hin1II CATG 2 cut(s) 179, 200
HincII GTYRAC 1 cut(s) 264
HindII GTYRAC 1 cut(s) 264
HphI GGTGA 1 cut(s) 228
Hpy166II GTNNAC 2 cut(s) 37, 264
Hpy188III TCNNGA 3 cut(s) 44, 142, 176
Hpy8I GTNNAC 2 cut(s) 37, 264
HpyCH4III ACNGT 1 cut(s) 114
HpyCH4V TGCA 1 cut(s) 126
HpyF10VI GCNNNNNNNGC 1 cut(s) 103
Hsp92II CATG 2 cut(s) 179, 200
KpnI GGTACC 1 cut(s) 345
Kzo9I GATC 2 cut(s) 40, 253
LmnI GCTCC 1 cut(s) 94
LpnPI CCDG 4 cut(s) 57, 261, 313, 324
LweI GCATC 1 cut(s) 194
MaeIII GTNAC 2 cut(s) 108, 234
MalI GATC 2 cut(s) 42, 255
MboI GATC 2 cut(s) 40, 253
MboII GAAGA 1 cut(s) 176
MluCI AATT 2 cut(s) 298, 349
MnlI CCTC 2 cut(s) 79, 250
MseI TTAA 3 cut(s) 132, 222, 318
MwoI GCNNNNNNNGC 1 cut(s) 103
NdeII GATC 2 cut(s) 40, 253
NlaIII CATG 2 cut(s) 179, 200
NlaIV GGNNCC 3 cut(s) 90, 282, 343
NmuCI GTSAC 2 cut(s) 108, 234
PagI TCATGA 1 cut(s) 175
PkrI GCNGC 1 cut(s) 96
PshBI ATTAAT 1 cut(s) 132
PspN4I GGNNCC 3 cut(s) 90, 282, 343
PspPI GGNCC 1 cut(s) 313
RsaI GTAC 1 cut(s) 343
RsaNI GTAC 1 cut(s) 342
SalI GTCGAC 1 cut(s) 262
SaqAI TTAA 3 cut(s) 132, 222, 318
SatI GCNGC 1 cut(s) 95
Sau3AI GATC 2 cut(s) 40, 253
Sau96I GGNCC 1 cut(s) 313
SetI ASST 1 cut(s) 78
SfaNI GCATC 1 cut(s) 194
SfcI CTRYAG 1 cut(s) 325
SmlI CTYRAG 1 cut(s) 142
SmoI CTYRAG 1 cut(s) 142
Sse9I AATT 2 cut(s) 298, 349
SsiI CCGC 2 cut(s) 92, 95
StyI CCWWGG 1 cut(s) 208
TaaI ACNGT 1 cut(s) 114
TaqI TCGA 1 cut(s) 263
TasI AATT 2 cut(s) 298, 349
TauI GCSGC 1 cut(s) 97
Tru1I TTAA 3 cut(s) 132, 222, 318
Tru9I TTAA 3 cut(s) 132, 222, 318
TscAI CASTG 1 cut(s) 117
TseFI GTSAC 2 cut(s) 108, 234
Tsp45I GTSAC 2 cut(s) 108, 234
TspDTI ATGAA 3 cut(s) 63, 164, 185
TspRI CASTG 1 cut(s) 117
VspI ATTAAT 1 cut(s) 132
XapI RAATTY 1 cut(s) 298
XmiI GTMKAC 2 cut(s) 36, 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.