Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002381.1

Orthogroup ID

OG0003120

Physical Location & Seq

Genomic Coordinates Reverse (-)

48319 .. 49830

Gene Structure 1512 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002381.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1080 bp

atggatactgctagtaagagctgggagcagaagtcattagttggggagatcattcaagggatggagctagcacaacagttgaggctaagtctgagtgcagcatcaacttcatcagaaactcgggagtttttagtgcaaaggatattgacctcgtacgagaaggcccttttgctactgcaattgagtggcacgcctcaaacatctcatgtggatgcaaaatccattgtgcttcaggagtctcgaatgtctgccaacacaagtccttgtggtgatgactataaccacaggagtttcaaggatcatcaggacctgcacgaaatctccaaaaagagaaagatcatggccaaatggactgaccatgtcataagggttagctctgagaatgggattgaaggacctcatgaagatggccatagctggagaaaatatgggcagaaagatattctaggagccaaatatcccagaagctactatagatgcaccttcaggaacacacaaaactgctgggctacaaagcaagtgcagagatcagatgaagaccctaccatatttgaaatcacatataaaggaaagcatacctgctctcatggcagcacatcagttccaccaccaccatcaccagaacagcaagaacaaaaaagacataagcgcgagaacatttctgaaccacagcagtctcaagtgaaccaaatgagctttccaactaatctgagggttgatactgagaatttggaagacagagagatgatggcatctccgttcgcttttacttcaacttcatttggatgcatgatgaatggagatgacttcctatctccgatgtttgataatgagaatttctttagcaatttctctcaacatttgctatctccagccactggcgaatcaaattaccacttggcaccaccaagccaaatgagaaacattgcagcgaacgggcaactttcagaatctgatcacactgagataatctcagccaccaattcctcaaccaattctccaattccagacatggatttcccactggatctagtggaattcgaccccaatttccaatttgacactccagaacttttctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AP2 WRKY

Protein Analysis

359

Amino Acids

40.74

Weight (kDa)

5.39

Isoelectric Point (pI)

54.5

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003120)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G11070 AT4G11070 AT4G23810
fragaria_vesca	FvH4_5g04370 FvH4_7g31050
malus_domestica	MD01G1215300.v1.1 MD06G1104100.v1.1 MD07G1285200.v1.1 MD07G1285400.v1.1 MD14G1123000.v1.1
prunus_persica	Prupe.2G307400_v2.0.a1 Prupe.5G117000_v2.0.a1 Prupe.5G117000_v2.0.a1 Prupe.5G117000_v2.0.a1
pyrus_communis	pycom01g22600 pycom06g09890 pycom07g25900
rosa_chinensis	RchiOBHm_Chr1g0380121 RchiOBHm_Chr7g0195191
rosa_laevigata	RLG00000004139 RLG00000026329
rosa_multiflora	Rmu_sc0001232.1_g000014 Rmu_sc0002381.1_g000011
rosa_roxburghii	Rroxscaffold_3G00260680 Rroxscaffold_4G00279660
rosa_rugosa	Rorug01G0417600 Rorug07G0021500
rosa_samantha	Rh1AG442800 Rh1BG397700 Rh1CG411200 Rh1DG428500 Rh7AG148800 Rh7BG150100 Rh7CG153600 Rh7DG150000
rosa_wichuraiana	Rw1G038450 Rw7G012710

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	2 cut(s)	318, 587
AccB1I	GGYRCC	1 cut(s)	901
AccB7I	CCANNNNNTGG	1 cut(s)	878
AccII	CGCG	1 cut(s)	651
AclWI	GGATC	2 cut(s)	306, 1035
AcoI	YGGCCR	2 cut(s)	342, 409
AcsI	RAATTY	3 cut(s)	727, 835, 1037
AcuI	CTGAAG	2 cut(s)	215, 469
AfaI	GTAC	1 cut(s)	155
AfiI	CCNNNNNNNGG	1 cut(s)	878
AgsI	TTSAA	5 cut(s)	56, 295, 392, 554, 774
AjuI	GAANNNNNNNTTGG	2 cut(s)	681, 713
AluBI	AGCT	6 cut(s)	21, 67, 375, 417, 468, 696
AluI	AGCT	6 cut(s)	21, 67, 375, 417, 468, 696
Alw26I	GTCTC	2 cut(s)	243, 681
AlwI	GGATC	2 cut(s)	306, 1035
AlwNI	CAGNNNCTG	3 cut(s)	310, 878, 953
Ama87I	CYCGRG	1 cut(s)	120
AoxI	GGCC	3 cut(s)	162, 342, 409
ApeKI	GCWGC	3 cut(s)	98, 591, 929
ApoI	RAATTY	3 cut(s)	727, 835, 1037
AspLEI	GCGC	1 cut(s)	651
AspS9I	GGNCC	3 cut(s)	163, 307, 395
AsuHPI	GGTGA	2 cut(s)	281, 609
AsuNHI	GCTAGC	1 cut(s)	67
AvaI	CYCGRG	1 cut(s)	120
AvaII	GGWCC	2 cut(s)	307, 395
BalI	TGGCCA	2 cut(s)	344, 411
BanI	GGYRCC	1 cut(s)	901
BbsI	GAAGAC	2 cut(s)	543, 741
BbvI	GCAGC	3 cut(s)	110, 603, 941
BccI	CCATC	4 cut(s)	55, 401, 622, 742
BclI	TGATCA	1 cut(s)	955
BcoDI	GTCTC	2 cut(s)	243, 681
BfaI	CTAG	4 cut(s)	12, 68, 446, 1031
BfmI	CTRYAG	1 cut(s)	472
BfuAI	ACCTGC	2 cut(s)	318, 587
BisI	GCNGC	3 cut(s)	99, 592, 930
BlsI	GCNGC	3 cut(s)	100, 593, 931
Bme18I	GGWCC	2 cut(s)	307, 395
BmeT110I	CYCGRG	1 cut(s)	120
BmgT120I	GGNCC	3 cut(s)	163, 307, 395
BmiI	GGNNCC	2 cut(s)	451, 903
BmsI	GCATC	5 cut(s)	110, 202, 467, 761, 776
BmtI	GCTAGC	1 cut(s)	71
BpiI	GAAGAC	2 cut(s)	543, 741
BplI	GAGNNNNNCTC	2 cut(s)	956, 988
BpmI	CTGGAG	3 cut(s)	439, 855, 1050
BpuEI	CTTGAG	1 cut(s)	663
BsaXI	ACNNNNNCTCC	6 cut(s)	17, 47, 305, 335, 982, 1012
Bsc4I	CCNNNNNNNGG	1 cut(s)	878
Bse1I	ACTGG	2 cut(s)	883, 1029
Bse3DI	GCAATG	1 cut(s)	924
BseGI	GGATG	3 cut(s)	66, 217, 791
BseLI	CCNNNNNNNGG	1 cut(s)	878
BseMI	GCAATG	1 cut(s)	924
BseMII	CTCAG	6 cut(s)	83, 369, 701, 714, 954, 987
BseNI	ACTGG	2 cut(s)	883, 1029
BseXI	GCAGC	3 cut(s)	110, 603, 941
BseYI	CCCAGC	2 cut(s)	21, 504
BsgI	GTGCAG	3 cut(s)	117, 296, 542
Bsh1236I	CGCG	1 cut(s)	651
BshFI	GGCC	3 cut(s)	164, 344, 411
BshNI	GGYRCC	1 cut(s)	901
BsiHKCI	CYCGRG	1 cut(s)	120
BsiWI	CGTACG	1 cut(s)	153
BslI	CCNNNNNNNGG	1 cut(s)	878
BsmAI	GTCTC	2 cut(s)	243, 681
BsnI	GGCC	3 cut(s)	164, 344, 411
BsoBI	CYCGRG	1 cut(s)	120
Bsp143I	GATC	6 cut(s)	48, 298, 336, 527, 955, 1027
BspANI	GGCC	3 cut(s)	164, 344, 411
BspCNI	CTCAG	6 cut(s)	84, 370, 702, 715, 955, 986
BspFNI	CGCG	1 cut(s)	651
BspHI	TCATGA	1 cut(s)	400
BspLI	GGNNCC	2 cut(s)	451, 903
BspMI	ACCTGC	2 cut(s)	318, 587
BspOI	GCTAGC	1 cut(s)	71
BspPI	GGATC	2 cut(s)	306, 1035
BspT107I	GGYRCC	1 cut(s)	901
BsrDI	GCAATG	1 cut(s)	924
BsrI	ACTGG	2 cut(s)	883, 1029
BssMI	GATC	6 cut(s)	48, 298, 336, 527, 955, 1027
Bst4CI	ACNGT	1 cut(s)	78
BstC8I	GCNNGC	2 cut(s)	69, 191
BstDEI	CTNAG	7 cut(s)	86, 92, 378, 710, 723, 963, 973
BstF5I	GGATG	3 cut(s)	66, 217, 791
BstFNI	CGCG	1 cut(s)	651
BstHHI	GCGC	1 cut(s)	651
BstKTI	GATC	6 cut(s)	51, 301, 339, 530, 958, 1030
BstMAI	GTCTC	2 cut(s)	243, 681
BstMBI	GATC	6 cut(s)	48, 298, 336, 527, 955, 1027
BstMWI	GCNNNNNNNGC	1 cut(s)	588
BstSFI	CTRYAG	1 cut(s)	472
BstUI	CGCG	1 cut(s)	651
BstV1I	GCAGC	3 cut(s)	110, 603, 941
BstV2I	GAAGAC	2 cut(s)	543, 741
BstX2I	RGATCY	1 cut(s)	1027
BstYI	RGATCY	1 cut(s)	1027
BsuRI	GGCC	3 cut(s)	164, 344, 411
BtsCI	GGATG	3 cut(s)	66, 217, 791
BtsIMutI	CAGTG	3 cut(s)	876, 960, 1022
BveI	ACCTGC	2 cut(s)	318, 587
Cac8I	GCNNGC	2 cut(s)	69, 191
CaiI	CAGNNNCTG	3 cut(s)	310, 878, 953
CciI	TCATGA	1 cut(s)	400
CfoI	GCGC	1 cut(s)	651
Cfr13I	GGNCC	3 cut(s)	163, 307, 395
Csp6I	GTAC	1 cut(s)	154
CviAII	CATG	7 cut(s)	206, 340, 359, 401, 587, 790, 1012
CviQI	GTAC	1 cut(s)	154
DdeI	CTNAG	7 cut(s)	86, 92, 378, 710, 723, 963, 973
DpnI	GATC	6 cut(s)	50, 300, 338, 529, 957, 1029
DpnII	GATC	6 cut(s)	48, 298, 336, 527, 955, 1027
EaeI	YGGCCR	2 cut(s)	342, 409
Eco47I	GGWCC	2 cut(s)	307, 395
Eco57I	CTGAAG	2 cut(s)	215, 469
Eco88I	CYCGRG	1 cut(s)	120
EcoO109I	RGGNCCY	3 cut(s)	163, 307, 395
EcoRI	GAATTC	1 cut(s)	1037
EcoT22I	ATGCAT	1 cut(s)	791
FaeI	CATG	7 cut(s)	209, 343, 362, 404, 590, 793, 1015
FatI	CATG	7 cut(s)	205, 339, 358, 400, 586, 789, 1011
FbaI	TGATCA	1 cut(s)	955
Fnu4HI	GCNGC	3 cut(s)	99, 592, 930
FokI	GGATG	3 cut(s)	73, 224, 798
Fsp4HI	GCNGC	3 cut(s)	99, 592, 930
FspBI	CTAG	4 cut(s)	12, 68, 446, 1031
GlaI	GCGC	1 cut(s)	650
GluI	GCNGC	3 cut(s)	99, 592, 930
GsaI	CCCAGC	2 cut(s)	25, 508
GsuI	CTGGAG	3 cut(s)	439, 855, 1050
HaeIII	GGCC	3 cut(s)	164, 344, 411
HhaI	GCGC	1 cut(s)	651
Hin1II	CATG	7 cut(s)	209, 343, 362, 404, 590, 793, 1015
Hin6I	GCGC	1 cut(s)	649
HinP1I	GCGC	1 cut(s)	649
HinfI	GANTC	3 cut(s)	236, 884, 950
HphI	GGTGA	2 cut(s)	281, 609
Hpy166II	GTNNAC	1 cut(s)	685
Hpy188III	TCNNGA	8 cut(s)	122, 233, 240, 305, 401, 487, 1007, 1067
Hpy8I	GTNNAC	1 cut(s)	685
HpyAV	CCTTC	3 cut(s)	154, 386, 493
HpyCH4III	ACNGT	1 cut(s)	78
HpyCH4V	TGCA	9 cut(s)	98, 136, 178, 215, 313, 480, 523, 789, 929
HpyF10VI	GCNNNNNNNGC	1 cut(s)	588
HpyF3I	CTNAG	7 cut(s)	86, 92, 378, 710, 723, 963, 973
Hsp92II	CATG	7 cut(s)	209, 343, 362, 404, 590, 793, 1015
HspAI	GCGC	1 cut(s)	649
Ksp22I	TGATCA	1 cut(s)	955
Kzo9I	GATC	6 cut(s)	48, 298, 336, 527, 955, 1027
LmnI	GCTCC	3 cut(s)	25, 64, 449
Lsp1109I	GCAGC	3 cut(s)	110, 603, 941
LweI	GCATC	5 cut(s)	110, 202, 467, 761, 776
MaeI	CTAG	4 cut(s)	12, 68, 446, 1031
MalI	GATC	6 cut(s)	50, 300, 338, 529, 957, 1029
MboI	GATC	6 cut(s)	48, 298, 336, 527, 955, 1027
MboII	GAAGA	3 cut(s)	416, 548, 746
MfeI	CAATTG	1 cut(s)	179
MflI	RGATCY	1 cut(s)	1027
MlsI	TGGCCA	2 cut(s)	344, 411
MluNI	TGGCCA	2 cut(s)	344, 411
MlyI	GAGTC	1 cut(s)	245
MmeI	TCCRAC	1 cut(s)	725
MnlI	CCTC	6 cut(s)	75, 160, 204, 408, 705, 997
Mox20I	TGGCCA	2 cut(s)	344, 411
Mph1103I	ATGCAT	1 cut(s)	791
MscI	TGGCCA	2 cut(s)	344, 411
MslI	CAYNNNNRTG	3 cut(s)	210, 405, 784
Msp20I	TGGCCA	2 cut(s)	344, 411
MunI	CAATTG	1 cut(s)	179
MvnI	CGCG	1 cut(s)	651
MwoI	GCNNNNNNNGC	1 cut(s)	588
NdeII	GATC	6 cut(s)	48, 298, 336, 527, 955, 1027
NheI	GCTAGC	1 cut(s)	67
NlaIII	CATG	7 cut(s)	209, 343, 362, 404, 590, 793, 1015
NlaIV	GGNNCC	2 cut(s)	451, 903
NsiI	ATGCAT	1 cut(s)	791
PagI	TCATGA	1 cut(s)	400
PfeI	GAWTC	2 cut(s)	884, 950
Pfl23II	CGTACG	1 cut(s)	153
PflFI	GACNNNGTC	1 cut(s)	359
PflMI	CCANNNNNTGG	1 cut(s)	878
PkrI	GCNGC	3 cut(s)	100, 593, 931
PleI	GAGTC	1 cut(s)	244
PpsI	GAGTC	1 cut(s)	244
PpuMI	RGGWCCY	2 cut(s)	307, 395
Psp5II	RGGWCCY	2 cut(s)	307, 395
PspFI	CCCAGC	2 cut(s)	21, 504
PspLI	CGTACG	1 cut(s)	153
PspN4I	GGNNCC	2 cut(s)	451, 903
PspPI	GGNCC	3 cut(s)	163, 307, 395
PspPPI	RGGWCCY	2 cut(s)	307, 395
PstNI	CAGNNNCTG	3 cut(s)	310, 878, 953
PsuI	RGATCY	1 cut(s)	1027
PsyI	GACNNNGTC	1 cut(s)	359
RsaI	GTAC	1 cut(s)	155
RsaNI	GTAC	1 cut(s)	154
RseI	CAYNNNNRTG	3 cut(s)	210, 405, 784
SatI	GCNGC	3 cut(s)	99, 592, 930
Sau3AI	GATC	6 cut(s)	48, 298, 336, 527, 955, 1027
Sau96I	GGNCC	3 cut(s)	163, 307, 395
SchI	GAGTC	1 cut(s)	245
SfaNI	GCATC	5 cut(s)	110, 202, 467, 761, 776
SfcI	CTRYAG	1 cut(s)	472
SinI	GGWCC	2 cut(s)	307, 395
SmiMI	CAYNNNNRTG	3 cut(s)	210, 405, 784
SmlI	CTYRAG	1 cut(s)	678
SmoI	CTYRAG	1 cut(s)	678
SspMI	CTAG	4 cut(s)	12, 68, 446, 1031
TaaI	ACNGT	1 cut(s)	78
TaqI	TCGA	2 cut(s)	241, 1041
TfiI	GAWTC	2 cut(s)	884, 950
TscAI	CASTG	3 cut(s)	883, 967, 1029
TseI	GCWGC	3 cut(s)	98, 591, 929
TspDTI	ATGAA	5 cut(s)	99, 417, 549, 768, 809
TspGWI	ACGGA	1 cut(s)	747
TspRI	CASTG	3 cut(s)	883, 967, 1029
Tth111I	GACNNNGTC	1 cut(s)	359
Van91I	CCANNNNNTGG	1 cut(s)	878
VpaK11BI	GGWCC	2 cut(s)	307, 395
XapI	RAATTY	3 cut(s)	727, 835, 1037
XspI	CTAG	4 cut(s)	12, 68, 446, 1031
Zsp2I	ATGCAT	1 cut(s)	791

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.